Тест ева д: Аптека Ригла – забронировать лекарства в аптеке и забрать самовывозом по низкой цене в Москва г.

Сдать ПЦР-тест на коронавирус теперь можно в медицинском центре «Ева клиник»

Сдать ПЦР-тест на коронавирус теперь можно в медицинском центре «Ева клиник». Мазок из носоглотки забирают ежедневно, кроме пятницы и субботы. Также на современном оборудовании проводятся исследования на наличие антител к Covid-19 в крови. В высокотехнологичной лаборатории побывала наша съемочная группа. Отдельный вход и соблюдение всех санитарно-гигиенических мер. В кабинете при записи на анализ ПЦР не более двух человек. Данные сразу вносят в Федеральный регистр. Мазок из носоглотки — это молекулярно-генетический анализ, который помогает выявить возбудителя СOVID-19. Исследование проводят в НИИ эпидемиологии и микробиологии Роспотребнадзора Хабаровска. Чтобы узнать иммунный ответ к вирусу, специалисты клиники возьмут кровь из вены.
Олеся Каспрова, заведующая КДЛ медицинского центра «Ева-клиник»:

«В лаборатории мы также проводим исследования по выявлению антител классов иммуноглобулина G и иммуноглобулина М, SARS-COV-2. Эти иммуноглобулины, они говорят о наличии…Есть ли антиген в крови у вас сейчас и переболели ли вы ранее».

Эти исследования выполняются в клинике. Биоматериал поднимают через передаточное окно. Доступ в Клинико-диагностическую лабораторию строго ограничен. Анализы проводят на современном диагностическом оборудовании и анализаторах последнего поколения.

Каждой пробирке присваивается свой уникальный штрих-номер, это нужно для того, чтобы избежать потери или подмены материала, а также исключить человеческий фактор. Но после каждого исследования специалисты клиники обязательно перепроверяют результаты лично. Этот аппарат иммуно-ферментного анализа предназначен не только для выявления COVID-19. Он также используется для гормональных и других исследований. Основное преимущество анализатора — скорость. Узнать результаты теста на антитела пациенты могут уже через два дня.

Надежда Слепышева, биолог КДЛ медицинского центра «Ева-клиник»:

«В нашей лаборатории мы используем контрольные материалы. Это позволяет нам определить качество наших постановок. Если контроли качества неудовлетворительны, мы переставляем все наши постановки до удовлетворительного контроля качества, чтобы быть уверенным в выдаваемом нами результате».

Также в клинике можно проверить функцию щитовидной железы, оценить функции репродуктивной системы, определить опухолевые маркёры, сдать биохимические анализы мочи и крови. Можно также получить сертификат о результатах ПЦР исследования для выезда за границу.

Дарья Лаптева

Органайзер д/хранения EVA корзинка Funny Коты, в ассорт Я4721Л

Страна производителя

Тип товара

Войлок синтетический

Для хранения

Наличие дизайна
С принтом


Корзинка для хранения EVA Funny Коты, в ассортименте с забавным принтом и аппликациями «Котяра» и «Котик». Предназначена для хранения вещей в любой комнате, от прихожей до ванной и спальни. Идеальна для одежды, игрушек, различных аксессуаров.

Тест ERA - определение правильного дня имплантации эмбриона

Тест ERA

Первый и единственный на сегодняшний день молекулярно-генетический подход для изучения зрелости эндометрия был разработан и внедрен в клиническую практику испанской лабораторией Igenomix, специализирующейся в проведении исследований в области репродуктивной генетики. Используемый Igenomix принцип основан на изучении уровня активности 238 генов, работа которых влияет на уровень рецептивности эндометрия. Результат анализа представляет собой график, отражающий количество особых молекул – РНК, каждая их которых строго соответствует одному из исследуемых генов. Форма графика меняется в зависимости от состояния зрелости эндометрия. Таким образом, по форме графика удается не только сделать вывод о зрелости эндометрия на момент биопсии, но и достоверно предсказать смещение периода «имплантационного окна» на несколько дней в одну или другую сторону, что невозможно точно определить с помощью методик, основанных на изучении морфологии клеток или уровня простагландинов.

Тест ERA (Endometrial receptivity analysis) – уникальное персонализированное исследование состояния зрелости эндометрия и его готовности к имплантации эмбриона, разработанное и внедренное в клиническую практику компанией Igenomix, Испания.

В основе точности и высокой клинической эффективности теста ERA лежат статистические данные, полученные в результате анализа большой выборки образцов эндометрия на этапе разработки теста. Каждый год компания Igenomix проводит тысячи исследований, результаты которых подтверждают точность и достоверность используемого алгоритма обработки данных. Именно уникальная методика оценки результатов делает тест ERA единственным и неповторимым в своем роде исследованием.

Клиническая эффективность теста ERA подтверждена в соответствии с принципами доказательной медицины.

Исследование эндометрия

Для проведения теста в определённый день цикла проводится биопсия образца ткани эндометрия. Исследование может быть проведено как в естественном цикле, так и в цикле заместительной гормональной терапии. Дальнейший анализ основан на технологии высокопроизводительного секвенирования (NGS). Переход к технологии NGS позволил еще более точно диагностировать состояние эндометрия. Кроме того, NGS позволяет получать данные не только об уровне активности генов, но и о микроорганизмах, живущих в эндометрии. В планах компании включить данные о микробиоме в заключение по результатам теста ERA.

Микробиом – совокупность микроорганизмов, живущих на поверхности или внутри тела человека, например, в кишечнике.

Кому показан тест ERA

Определение рецептивности эндометрия и периода «имплантационного окна» молекулярно-генетическим методом (тест ERA) рекомендуется проводить:

  • женщинам моложе 37 лет, имеющим в анамнезе 3 неудачных попытки ЭКО при условии переноса морфологически полноценного эмбриона, отсутствия у них видимой патологии матки и эндометрия (его толщина должна быть не менее 6 мм),
  • женщинам в возрасте 37 лет и старше при 2 неудачных попытках ЭКО. У каждой четвертой из таких пациенток определяется смещение периода «имплантационного окна».
  • При бесплодии неясного генеза, когда исключены иные возможные причины.
  • При подозрении на снижение рецептивности эндометрия у женщин любого возраста.
  • При подготовке к донорским циклам ЭКО.

Оценка рецептивности эндометрия в этих случаях помогает более точно оценить шансы наступления беременности и при необходимости скорректировать тактику лечения бесплодия.

Почему мы?

Почему необходимо провести исследование рецептивности эндометрия и определить «имплантационное окно» в ЦМРТ на Яузе?

Международное сотрудничество
Клинический Госпиталь на Яузе является единственным партнером компании Igenomix в России, и представляет весь спектр услуг Igenomix, в том числе и тест ERA.
Наши специалисты проводят полный цикл подготовки к исследованию и биопсию образца эндометрия.
Собственное криохранилище и возможность витрификации эмбрионов на стадии бластоцисты до получения результатов исследования позволяют нам синхронизировать развитие эмбриона и время переноса.
Применение техники механической стимуляции эндометрия, способствующей увеличению его толщины, дополнительно повышает шанс успешной имплантации.


Мы приглашаем как пациенток, так и профессионалов-репродуктологов обращаться к нам и использовать тест ERA для повышения результативности ЭКО.
Требования к забору и отправке материала узнайте у наших специалистов.

Наши специалисты:

Используйте достижения современной медицины и мощный потенциал ЦМРТ на Яузе для достижения главной цели - рождения ребенка.

Работаем без выходных

Обслуживание на двух языках: русский, английский.
Оставьте свой номер телефона, и мы обязательно перезвоним вам.

Медицинский центр "Вера" в Твери

Дарья Николаева

Добрый день! Пишу отзыв с благодарностью массажисту Новрузу Гаджиеву за работу с моей спиной. Я обратилась с жалобами на "зажатость" мышц шейного и грудного отделов позвоночника и в целом на правостороний сколиоз. Основными мишенями массажа стали: расслабление мышц правой стороны спины, снятия с них спазма и тонизирование мышц левой, восстановление баланса. За 5 сеансов общего массажа спины нам удалось значительно расслабить мышцы, эффект начинает проявляться уже после первого сеанса (после которого может ощущатьсяи небольшая боль в мышцах, но это означает их глубокую проработку и быстро проходит, мне нравится 😉 ). Убрали спазмы с шейного отдела: я чувствую и вижу, как у меня расслабились и опустились плечи, за счёт чего удилинилась шея, это здорово! А то короткая и вытянутая вперед шея - бич всех офисных сотрудников - это ужасно некрасиво. На последнем, 5-ом, сеансе мы дополнительно сделали вакуумный массаж на правую сторону (предварительно готовили спину к этому) - ощущения интересные и потрясающие! Мышцы чувствуются ещё лучше - именно этого я и ждала )). Обещаю поддерживать результат гимнастикой и упражнениями ))

Также необходимо отметить умение Новруза создать комфортные условия для пациента, его внимательное отношение и профессионализм, серьёзную не только практическую подготовку, но и теоретическую. Объясняется каждый этап работы и его значение для общего результата. Дополнительно я узнала, что здоровая спина, ровный позвоночник - это хорошее движение лимфы, кровоснабжение, что означает достаточное насыщение органов и тканей кислородом и питательными веществами, вывод шлаков, правильную работу внутренних органов, соответсвенно хорошее самочувствие в целом, а также замедление процессов старения (милые дамы, для нас это особенно важно

Недостатки автоковриков EVA: надежность, скрип

Если вас заинтересовала информация о недостатках ковриков, производимых из сверхлегкого материала EVA, наверняка вы знакомы и с их неоспоримыми преимуществами.

Безопасность, морозоустойчивость, возможность выбора дизайна, идеально подходящего вашему автомобилю, а самое главное – чистота салона в любую погоду благодаря специальной поверхности, правильно продуманным вариантам крепления и максимальной широте покрытия пола по адекватным ценам – все это о них.

Перечисленное настолько привлекательно, что невольно закрадывается сомнение, правда ли это? Разве возможно, чтобы не было ни единого минуса в товаре? У каждой медали есть 2 стороны и наши автоковрики не исключение.

Не встречаются в розничной продаже.

Если вы планировали провести время в магазинах и подбирая подходящие детали в салон своего любимого автомобиля, то EVA коврики точно вам не подойдут. Всего пара кликов компьютерной мышью отделяют вас от числа счастливцев, владеющих этими ковриками. Кроме того, вам придется подумать над дизайном, подходящим именно вам, выбрать необходимую комплектацию и материал на нашем сайте. После того, как вы подтвердите заказ, индивидуально под ваш автомобиль будут изготовлены коврики, бережно упакованы и доставлены в соответствии с вашими указаниями. В общем, вынуждены признать, этот вариант не рассчитан на автолюбителей, предпочитающих знакомиться с товаром лично.

Поскрипывают при соприкосновении с обувной подошвой.

Как бы нам не хотелось, но данный недостаток невозможно устранить в силу особенностей материала, являющегося основой коврика. При изменении положения ног вы будете слышать легкое поскрипывание, подобное тому, которое издают коврики из резины. Если подобные звуки вызывают неприятные ощущения по всему телу, от EVA-ковриков придется отказаться, впрочем, как и от любых резиновых ковриков тоже.

Меньше времени на релакс.

Вы провели много приятных часов, попивая обжигающий ароматный кофе в ожидании своей очереди на автомойке? С ковриками DUNLIN такие мгновения станут редкостью. Неважно, сколько луж вам пришлось преодолеть по пути к автомобилю, какое количество снега налипло на подошвы ботинок – ромбовидные ячейки ковриков не оставят грязи ни малейшего шанса. Полы в салоне сохранят чистоту, даже если вы полностью откажетесь от привычки отряхивать обувь перед посадкой в машину. Теперь не придется по несколько раз в неделю уделять время чистке салона, а значит, и возможностей для беззаботного времяпровождения станет меньше. И это то, с чем вам придется примириться.

Осторожно! Вызывают привыкание!

Нам неоднократно приходилось наблюдать, как человек, не интересующийся такими малозначительными, на первый взгляд, деталями как автомобильные коврики, совершенно преображался после приобретения наших ковров. Мы не можем гарантировать, что спустя некоторое время коврики Данлин не поселятся в автомобилях членов вашей семьи и друзей. Вполне вероятно и то, что благодаря вам коллеги и знакомые будут разбираться во всех тонкостях выбора ковриков для машины, а ваша жизнь станет более свободной и комфортной.


Пока нет комментариев

Написать комментарий




Avis et Test - eva коврики автомобильные акцент

Offres spéciales sur les eva коврики автомобильные акцент on aliexpress

Quel que soit l’objet de votre désir, la plateforme d’AliExpress est une véritable mine d’or. Une envie de eva коврики автомобильные акцент? N’allez pas plus loin! Nous proposons des milliers de produits dans toutes les catégories de vente, afin de satisfaire toutes vos envies. Des grandes marques aux vendeurs plus originaux, du luxe à l’entrée de gamme, vous trouverez TOUT sur AliExpress, avec un service de livraison rapide et fiable, des modes de paiement sûrs et pratiques, quel que soit le montant et la quantité de votre commande.

Sans oublier les économies dont vous pouvez bénéficier grâce aux prix les plus bas du marché et à des remises sensationnelles. Votre eva коврики автомобильные акцент va faire envie à tous vos proches, croyez-nous!"

AliExpress compare pour vous les différents fournisseurs et toutes les marques en vous informant des prix et des promotions en vigueur. Notre site regroupe également des commentaires de véritables clients, chaque produit étant noté selon plusieurs critères commerciaux. Tous les éléments sont réunis pour vous aider à prendre la meilleure décision, en fonction de vos besoins et de vos envies. Il vous suffit de suivre les conseils des millions de clients satisfaits par nos services."

Alors n’attendez plus, offrez-vous votre/vos eva коврики автомобильные акцент! Qualité et petits prix garantis, il ne vous reste plus qu’à valider votre panier et à cliquer sur «Acheter maintenant». C’est simple comme bonjour. Et parce que nous adorons vous faire plaisir, nous avons même prévu des coupons pour rendre votre achat encore plus avantageux. Pensez à les récupérer pour obtenir ce(s) eva коврики автомобильные акцент à un prix imbattable."

Chez AliExpress, rien ne nous rend plus fier que la lecture des retours positifs de notre chère clientèle, c’est pourquoi nous nous engageons à leur offrir le meilleur.

Перфузия головного мозга, когнитивные функции и сосудистый возраст у пациентов среднего возраста с эссенциальной артериальной гипертензией | Парфенов

1. Nilsson P. M., Boutouyrie P., Laurent S. Vascular aging: a tale of EVA and ADAM in cardiovascular risk assessment and prevention. Hypertension 2009; 54: 3-10. DOI: 10.1161/HYPERTENSIONAHA.109.129114

2. Карпов Ю. А., Сорокин Е. В. Оценка риска осложнений при артериальной гипертонии и сосудистый возраст: новые инструменты для повышения качества лечения и улучшения взаимопонимания врача и больного. Атмосфера. Новости кардиологии 2015; 2: 18-24

3. Groenewegen K. A., den Ruijter H. M., Pasterkamp G. et al. Vascular age to determine cardiovascular disease risk: A systematic review of its concepts, definitions, and clinical applications. European Journal of Preventive Cardiology 2016; 23 (3): 264-274. DOI: 10.1177/2047487314566999

4. Cuende J. I., Cuende N., Calaveras-Lagartos J. How to calculate vascular age with the SCORE project scales: a new method of cardiovascular risk evaluation. European Heart Journal 2010; 31 (19): 2351-2358. DOI: 10.1093/eurheartj/ehq205

5. DAgostino R. B., Vasan R. S., Pencina M.J. et al. General cardiovascular risk profile for use in primary care. Circulation 2008; 117 (6): 743-753. DOI: 10.1161/CIRCULATIONAHA.107.699579

6. Stein J. H., Fraizer M., Aeschlimann S. E. et al. Vascular age: Integrating carotid intima-media thickness measurements with global coronary risk assessment. Clinical Cardiology 2004; 27 (7): 388-392.

7. Протасов К. В., Cинкевич Д. А., Федоришина О. В., Дзизинский А. А. Сосудистый возраст как интегральный показатель ремоделирования сердца и сосудов у больных артериальной гипертензией. Сибирский медицинский журнал (Иркутск) 2011; 105 (6): 37-40

8. Mancia G., Fagard R., Narkiewicz K. et al. 2013 ESH/ESC Guidelines for the management of arterial hypertension. The Task Force for the management of arterial hypertension of the European Society of Hypertension (ESH) and of the European Society of Cardiology (ESC). J. Hypertension 2013; 31: 1281-1357. DOI: 10.1093/eurheartj/eht151

9. Пронин И. Н., Фадеева Л. М., Подопригора А. Е. и др. Спиновое маркирование артериальной крови (ASL) - метод визуализации и оценки мозгового кровотока. Лучевая диагностика и терапия 2012; 3 (3): 64-78

10. Nasreddine Z. S., Phillips N. A., Bedirian V. et al. The Montreal cognitive assessment, MoCA: a brief screening tool for mild cognitive impairment. J. Am Geriatr Soc 2005; 53: 695-699. DOI: 10.1111/ j.1532-5415.2005.53221.x

11. Nasreddine Z. MoCA Russian version, 2010. Available from: http://www.mocatest.org/wp-content/uploads/2015 /tests-instructions/MoCA-Test-Russian_2010.pdf

12. Morris J. C., Heyman A., Mohs R. C. et al. The Consortium to Establish a Registry for Alzheimer's Disease (CERAD). Part I. Clinical and neuropsychological assessment of Alzheimer's disease. Neurology 1989; 39: 1159-1165.

13. Парфенов В. А., Захаров В. В., Преображенская И. С. Когнитивные расстройства. М., 2014, 192 с

14. Reitan R. Validity of the Trail Making Test as an indicator of organic brain damage. Percept Mot Skills 1958; 8: 271-276.

15. MacLeod C. M. Half a century of research on the Stroop effect: An integrative review. Psychol Bull 1991; 109 (2): 163-203.

16. Nilsson P. M. Genetic and environmental determinants of early vascular ageing (EVA). Current vascular pharmacology 2012; 10 (6): 700-701. DOI: 10.2174/157016112803520981

17. Zhang Y., Lelong H., Kretz S. et al. Characteristics and Future Cardiovascular Risk of Patients With Not-At-Goal Hypertension in General Practice in France: The AVANT' AGE Study. The Journal of Clinical Hypertension 2013; 15 (4): 291-295. DOI: 10.1111/jch.12082

18. Диагностика и лечение артериальной гипертензии. Российские рекомендации (четвертый пересмотр). Системные гипертензии 2010; 3: 5-26

19. Солсо Р. Когнитивная психология. 6-е изд. СПб.: Питер 2015; 592 с.

20. Алфимова М. В. Семантическая вербальная беглость: нормативные данные и особенности выполнения задания больными шизофренией. Социальная и клиническая психиатрия 2010; 20 (3): 20-25

21. Ostrosky-Solis F., Gutierrez A. L., Flores M. R., Ardila A. Same or different? Semantic verbal fluency across Spanish-speakers from different countries. Arch Clin Neuropsychol 2007; 22: 367-377. DOI: 10.1016/j. acn. 2007.01.011

22. Парфенов В. А., Старчина Ю. А. Когнитивные нарушения у пациентов с артериальной гипертензией и их лечение. Неврология, нейропсихиатрия, психосоматика 2011; 3 (1): 27-33

23. Reitz C., Tang М. Х., Manly J. et al. Hypertension and the Risk of Mild Cognitive Impairment. Arch Neurol 2007; 64 (12): 1734-1740. DOI: 10.1001/archneur. 64.12.1734

24. Gifford K. A., Badaracco M., Liu D. et al. Blood Pressure and Cognition Among Older Adults: A Meta-Analysis. Archives of Clinical Neuropsychology 2013; 28 (7): 649-664. DOI: 10.1093/arclin/act046

25. Sierra С., de la Sierra A., Salamero M. et al. Silent Cerebral White Matter Lesions and Cognitive Function in Middle-Aged Essential Hypertensive Patients. Am J. Hypertens 2004; 17: 529-534. DOI: 10.1016/j.amjhyper. 2004.02.014

26. Sierra C. and Coca A. White Matter Lesions and Cognitive Impairment as Silent Cerebral Disease in Hypertension. The Scientific World Journal 2006; 6: 494-501. DOI: 10.1100/tsw.2006.99

27. Wang T., Li Y., Guo X. et al. Reduced perfusion in normal-appearing white matter in mild to moderate hypertension as revealed by 3D pseudocontinuous arterial spin labeling. J. Magn Reson Imaging 2016; 43 (3): 635-643. DOI: 10.1002/jmri.25023

28. Pantoni L. Cerebral small vessel disease. Lancet. Neurology 2010; 9: 689-701. DOI: 10.1016/S1474-4422 (10) 70104-6.

29. Guyton А. С., Hall J. E. Textbook of medical physiology 11th ed. Elsevier 2006; 761p.

30. Ostrow P. T., Miller L. L. Pathology of small artery disease. Adv Neurol 1993; 62: 93-125.

31. Левин О. С. Патология белого вещества при дисциркуляторной энцефалопатии: диагностические и терапевтические аспекты. Трудный пациент 2011; 9 (12): 16-23

32. Дамулин И. В., Парфенов В. А., Скоромец А. А., Яхно Н. Н. Нарушения кровообращения в головном и спинном мозге. В. кн. Болезни нервной системы. Руководство для врачей. М.: Медицина 2005; 231-302

33. Ungvari Z., Kaley G., de Cabo R. et al. Mechanisms of vascular aging: new perspectives. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 2010; 65 (10): 1028-1041. DOI: 10.1093/gerona/glq113

34. Csiszar A., Tarantini S., Fülöp G. A. et al. Hypertension impairs neurovascular coupling and promotes microvascular injury: role in exacerbation of Alzheimer's disease. Geroscience 2017; 39 (4): 359-372. DOI: 10.1007/s11357-017-9991-9.

35. Brown W. R., Moody D. M., Thore C. R. et al. Vascular dementia in leukoaraiosis may be a consequence of capillary loss not only in the lesions, but in normal-appearing white matter and cortex as well. J. Neurol Sci 2007; 257 (1-2): 62-66. DOI: 10.1016/j.jns.2007.01.015

36. Riddle D. R., Sonntag W. E., Lichtenwalner R. J. Microvascular plasticity in aging. Ageing research reviews 2003; 2 (2): 149-168. DOI: 10.1016/S1568-1637(02)00064-8

37. Rivard A., Fabre J. E., Silver M. et al. Age-dependent impairment of angiogenesis. Circulation 1999; 99 (1): 111-120. DOI: 10.1161/01.CIR. 99.1.111

Ева Доддс | Советник по приему в колледж

Ева Доддс, советник по колледжу

Ева начала свою карьеру при поступлении в колледж в 1991 году. С тех пор она работала с тысячами абитуриентов в двух приемных комиссиях (Гарвардский университет и Колледж Вустера) и трех средних школах ( Детройтская деревенская дневная школа, школа Холтон-Армс и школа Св. Иоанна в Хьюстоне). Она посетила множество колледжей и дважды была сертифицирована Гарвардским приемным институтом. Ева является активным членом Национальной ассоциации консультирования при поступлении в колледж и входила в ее президентский совет в качестве президента Мичиганской ассоциации консультирования при поступлении в колледж.

Ева увлечена работой со старшеклассниками и их семьями, пока они поступают в колледж. Ей нравится сочетать уникальные таланты и характеристики студентов с идеальными колледжами, обеспечивая при этом, чтобы каждый абитуриент был продемонстрирован с максимальной выгодой в процессе подачи заявления в колледж. Она специализируется на консультировании спортсменов, художников и артистов-исполнителей, а также имеет опыт приема в международные университеты, включая систему UCAS и канадскую университетскую систему.

Рожденная на той же неделе, когда тренер-новичок Бо Шембехлер расстроил штат Огайо и люди ходили по Луне, Ева всегда была поклонницей тех, кто мечтает о большом. Она считает, что у нее лучшая работа на планете, помогая студентам открывать новые возможности и выбирать вдохновляющие пути. Когда она не работает со студентами, Ева обычно бросает или пинает мяч вместе со своим сыном и их собакой.

Образование и опыт

Президент Мичиганской ассоциации по консультированию при поступлении в колледж 2016-2017

Премия MACAC Rising Star (2010) присуждена как независимый консультант

Премия MACAC Up and Coming Member Award (2002) присуждена как школьный советник

Основатель American College Consulting (2005)

Советник колледжа, декан студентов, учитель истории, тренер в Детройтской сельской дневной школе, Беверли-Хиллз, Мичиган

Директор по консультированию колледжей, тренер по футболу и легкой атлетике в школе Холтон-Армс, Бетесда, Мэриленд

Советник колледжа, учитель истории, тренер по бегу по пересеченной местности, футболу и легкой атлетике в университете Св.John's School, Хьюстон, Техас

C.A.S. в области администрирования, планирования и социальной политики, Гарвардская высшая школа образования; M.Ed. & Аттестация учителей средней школы, Университет Джона Кэрролла; Б.А. История, Колледж Вустера

Более 25 лет опыта работы с тысячами студентов

Членство в профессиональных организациях

NACAC: Национальная ассоциация консультирования при поступлении в колледж

MACAC: Мичиганская ассоциация консультирования при поступлении

Связаться с

Eva Sapi, Ph.D. - Университет Нью-Хейвена,


к.т.н. Генетика и молекулярная биология - 1995 Университет Этвоша Лорана, Будапешт, Венгрия
M.S. Генетика и молекулярная биология - 1987 Университет Этвоша Лорана, Будапешт, Венгрия

О Еве

Ева Сапи - всемирно признанный эксперт в области исследования болезни Лайма. Она находится на переднем крае поиска лекарства от болезни, которую Центры по контролю за заболеваниями называют самой быстрорастущей трансмиссивной болезнью в Соединенных Штатах.

Она была первой, кто обнаружил присутствие биопленки боррелий в инфицированной ткани кожи человека. Это открытие было опубликовано в Европейском журнале микробиологии и иммунологии, международном рецензируемом онлайн-журнале, представляющем одну из ее 70 рецензируемых научных статей по теме: Болезнь Лайма. Директор университетской программы исследования болезни Лайма, доктор Сапи обучил более 90 аспирантов исследованиям болезни Лайма.

Текущее исследование доктора Сапи с Джеймсом Голдманом, профессором патологии и клеточной биологии Колумбийского университета, сосредоточено на случае, когда женщина получала 16 лет антибиотикотерапии и все же умерла от болезни Лайма. Их результаты, опубликованные в Healthcare 2018, подтвердили ее более ранние открытия, что боррелия может образовывать биопленку, защитный слой вокруг себя, что делает ее чрезвычайно устойчивой к антибиотикам.

ДокторСапи и ее ученики продолжают изучать недавний прорыв, в ходе которого они обнаружили, что жидкий экстракт стевии из цельного листа, а не порошкообразные разновидности, которые люди чаще всего используют, уменьшили массу биопленки примерно на 40 процентов.

Цель ее исследования - выявить новые антибактериальные агенты, которые эффективны при уничтожении всех форм боррелий.

Признанная Общей Массачусетской школой / Гарвардской медицинской школой за исследования болезни Лайма, д-р.В 2018 году сайт LymeDisease.org назвал Сапи первопроходцем в исследованиях. Она делилась своими выводами на конференциях по всей стране и организовала шесть симпозиумов по болезни Лайма в Университете Нью-Хейвена, которые регулярно собирают 200 участников, и она получила Лайм-коннект из Риджфилда. Награда за смелость.

Первоначальное исследование доктора Сапи было сосредоточено на раке груди и яичников. Она переключила свое внимание на поиск лучшего лечения болезни Лайма после того, как сама заразилась.Она прошла постдокторскую подготовку в Медицинской школе Йельского университета и получила степень доктора философии. по генетике в Университете Этвоша Лоранда в Будапеште, Венгрия.

Узнать больше Видеть меньше
Области исследований

Болезнь Лайма, патогенная биопленка, устойчивость к антибиотикам, различная морфология Borrelia burgdorferi

Последние статьи

Сапи Э, Гупта К., Вавржениак К., Гаур, Дж., Торрес Дж, Филуш К., Мелилло А, Злгер Б (2019) Боррелии и хламидии могут образовывать смешанные биопленки в инфицированных тканях кожи человека.Здравоохранение (Базель), 9 (2), pii 46-55, doi: 10.1556 / 1886.2019.00003

Миддельвин М.Дж., Филуш К.Р., Бандоски С., Касилаула Р.С., Мелилло А., Стрикер Р.Б., Сапи Э. (2019) Смешанные биопленки Borrelia burgdorferi и Helicobacter pylori в дерматологических образцах, вызванных болезнью моргеллонов. Здравоохранение (Базель), 7 (2), pii 70, doi: 10.3390 / healthcare7020070

Сапи Е., Касливала Р.С., Исмаил Х, Торрес Дж. П., Олдаковски М., Маркланд С., Гаур Г., Мелилло А., Эйзендл К., Лигнер К., Либиен Дж., Голдман Дж. (2019) Долгосрочная устойчивость антигенов Borrelia burgdorferi и ДНК в Ткани пациента с болезнью Лайма.Антибиотики, 8 (4), pii 183, doi: 10.3390 / antibiotics8040183

Soccaras, KM, Theophilus PAS, Torres, JP, Gupta K, Sapi E (2017) Антимикробная активность пчелиного яда и меллиттина против Borrelia. Антибиотики (Базель), 29; 6 (4), pii E70, doi: 10.3390 / antibiotics6040031

Middelveen MJ, Sapi E, Burke J, Filush KR, Franco A, Fesler MC, Stricker RB. (2018) Персистирующая инфекция Borrelia у пациентов с продолжающимися симптомами болезни Лайма.Здравоохранение, 6, 33, pii E33, doi: 10.3390 / healthcare602003

Сапи Е., Гупта, К., Вавжениак К., Гаури Г., Торрес Дж, Филуш К.Р., Мелилло А., Зельгер Б. (2019) Боррелии и хламидии могут образовывать смешанные биопленки в инфицированных тканях кожи человека. Европейский журнал микробиологии и иммунологии, 9 (2), 46-55. DOI: 10.1556 / 1886.2019.00003

Middelveen MJ, Filush KR, Stricker RB, Sapi, E. Смешанные биопленки Borrelia и Helicobacter pylori в дерматологических образцах болезни Моргеллонов (2019) Healthcare, 17,7 (2).pii: E70. DOI: 10.3390 / healthcare7020070.

Сапи Э, Баласубраманиан К., Порури А., Магсудлу Дж.С., Теофил, П.А.С., Сокаррас К.М., Тиммараджу А.В., Филуш К.Р., Гупта К., Шейх С., Люке Д.Ф., Макдональд А., Зельгер Б. (2016) Доказательства существования in vivo биопленки боррелий в боррелиальных лимфоцитомах европейский Журнал микробиологии и иммунологии, DOI: http: // dx.doi.org/10.1556/1886.2015.00049

Sapi E, Theophilus, PAS, Burugu D, Luecke DF. (2016) Эффект Rpon, Rpos и Luxs пути формирования биопленок и чувствительности Borrelia burgdorferi к антибиотикам. Европейский журнал микробиологии и иммунологии, 1 декабря; 6 (4): 272–286.

Shaikh S, Timmaraju VA, Torres JP, Socarras KM, PAS, Sapi E. (2016) Влияние клеща и физиологические температуры млекопитающих на биопленках Borrelia burgdorferi.Микробиология, Ноябрь; 162 (11): 1984-1995. DOI: 10.1099 / mic.0.000380.

Теофил, PAS, Виктория MJ, Socarras KM, Filush KR, Gupta K, Luecke DF, Sapi E. (2015) Эффективность экстракта цельного листа Stevia rebaudiana против различных морфологических формы Borrelia burgdorferi in vitro Европейский журнал микробиологии и иммунологии, DOI: 10.1556 / 1886.2015.00031

Timmaraju A, Theophilus PAS, Balasubramanian K, Luecke DF и Sapi E.Образование биопленки европейскими штаммами Borrelia burgdorferi sensu lato in vitro. (2015) Письма FEMS, DOI: 10.1093 / femsle / fnv120. Epub 2015 24 июля.

Сапи Э, Паббати Н., Датар Д., Дэвис Э.М., Ратталле А., Куо Б.А. (2013) Условия культивирования для роста и обнаружения Borrelia в сыворотке крови человека. Международный журнал Медицинские науки 10 (4): 362-376. DOI: 10.7150 / ijms.5698.

Сапи Э, Бастиан С.Л., Мпой С.М., Скотт С., Раттель А., Паббати Н., Порури А., Буругу Д., Теофил PAS, Pham TV, Datar D, Dhaliwal NK, Timmaraju A. Rossi MJ, Sinha SK, MacDonald A и Luecke DF. (2012) Характеристика образования биопленок Borrelia burgdorferi в пробирка. PLoS ONE 7 (10) октября: e48277.

См. Полную информацию о резюме См. Менее полную информацию о резюме

Ева М.Кармона Поркера, доктор медицины, доктор философии - Профили преподавателей клиники Мэйо


Научные интересы Евы М. Кармона Поркера, доктора медицины, доктора философии, центр исследований защиты легких, инфекций и фиброза. Ее исследование направлено на лучшее понимание защиты легких в связи с инфекцией у хозяев с ослабленным иммунитетом. Кроме того, доктор Кармона Поркера изучает механизмы фиброза легких при идиопатической интерстициальной пневмонии.

Зоны фокусировки

  • Модуляция иммунной защиты хозяина с помощью бета-глюканов пневмоцисты.Доктор Кармона Поркера - главный исследователь исследования, изучающего потенциальную роль бета-глюкана пневмоцист (PCBG) как прямого активатора В-клеток. Это важно, поскольку PCBG - помимо участия в активации CD4 через дендритные клетки - также может опосредовать независимую от CD4 активацию иммунной системы. Ее новые открытия показали, что В-клетки играют важную роль в секреции ИЛ-8 для рекрутирования нейтрофилов. Эти исследования важны, поскольку они показывают новую роль В-клеток во врожденной иммунной системе.Лаборатория также работает над моделью вакцины от пневмоцистной пневмонии с использованием ПХБГ в качестве адъюванта.
  • В-клеток в развитии фиброза легких. Доктор Кармона Поркера и Тобиас Пайкерт, доктор медицины, проводят исследование роли В-клеток в развитии фиброза легких у подгруппы пациентов с диффузными интерстициальными заболеваниями легких. Основное внимание в этом исследовании уделяется определению роли активированных В-лимфоцитов в активации фибробластов, которые, по мнению доктора Кармона Поркера и его коллеги, играют важную роль в развитии фиброза легких.

    Лаборатория выдвигает гипотезу о том, что высокий риск неэффективности текущих методов лечения у этих пациентов является результатом неточного отбора или классификации этих пациентов на основе морфологического сходства, а не функциональных иммунологических исследований. Предлагаемые анализы помогут идентифицировать этих пациентов на основе их функциональных иммунологических характеристик, и они предполагают, что терапия с истощением В-клеток, вероятно, будет успешной при назначении правильным пациентам.

  • Геномный и протеомный анализ лимфангиолейомиоматоза (ЛАМ) болезни легких. Вместе с доктором философии Джорджем Васматзисом доктор Кармона Поркера возглавляет проект, направленный на характеристику ландшафта перестроек ДНК в образцах тканей пациентов с ЛАМ. Утвержденные варианты будут оцениваться на предмет клинической применимости и рекомендованы в качестве биомаркеров для разработки тестов.

Значение для ухода за пациентами

Работа доктора Кармона Поркера с PCBG очень важна с клинической точки зрения, поскольку она может позволить врачам управлять и повышать иммунитет пациентов с дефектной иммунной системой.Кроме того, ее работа над моделью вакцины от пневмоцистной пневмонии потенциально поможет предотвратить эту грибковую инфекцию.

Аналогичным образом, разрабатываемые B-клеточные анализы позволят прогнозировать пациентов с риском развития фиброза легких, а также выявлять пациентов, которым будет полезна терапия с истощением B-клеток, например ритуксимаб.

Наконец, анализ ЛАМ, проведенный доктором Кармона Поркера, будет способствовать разработке более точных диагностических инструментов.

Профессиональные особенности

  • Программный комитет, микробиология, туберкулез и легочные инфекции, Американское торакальное общество, с 2014 г. по настоящее время
  • Награды Уолтера и Леоноры Анненберг за развитие карьеры в области легочной медицины, Подкомитет по развитию карьеры и разнообразию, клиника Мэйо, 2013-2016 гг.
  • г.и г-жа Дж. Томас Хурвис за исследования в области интерстициальных заболеваний и гранта операционного фонда фиброза легких, Caerus Foundation, 2014-2015 гг.
  • Признание «Лучшим преподавателем», отделение внутренней медицины, клиника Мэйо, 2013, 2014
  • Премия за развитие научной карьеры, отделение внутренней медицины, клиника Мэйо, 2012-2014 гг.
  • Содружество семьи Бюргеров по легочным заболеваниям, 2011 г.

Новости и события - Университет Хьюстона

В центре внимания студентов: Ева Коффи, Ph.Доктор политических наук

Декабрь 2012 г. Выпускник, уроженец Чешской Республики, стажируется дипломатом США.

Д-р Ева Коффи, Ph.D. Кандидат политических наук '12, поступила в качестве дипломата на стажировку в Государственный департамент США, которым Мадлен Олбрайт (справа) руководила с 1997 по 2001 год как первая женщина, ставшая госсекретарем США.

Ева Коффи работала над своей диссертацией по политологии, когда в оповещении Google появилась новость о том, что посол США Дж. Кристофер Стивенс и трое его сотрудников были убиты во время нападения на США.С. Консульство в Ливии.

Трагедия стала отрезвляющим напоминанием о том, что дипломатическая работа, которую она провела месяцами, проверяя и проводя собеседования, опасна.

«Я уже прошел все собеседования по поводу работы», - сказал Коффи. «Я входил в группу Google, созданную для людей, которые находились на этом этапе процесса найма, и сообщения, которыми мы обменивались, показали, что атаки еще больше укрепили решимость каждого присоединиться к сервису.

«Каждая работа сопряжена с определенным уровнем риска.Все мы знали о рисках, связанных с этим процессом, и Государственный департамент хорошо справляется с объяснением рисков в своих информационных материалах, чтобы они получали только тех кандидатов, которые готовы на это пойти. Если вы считаете, что ваша работа преследует цель, вы соглашаетесь на риск ».

Образование и опыт доктора Коффи в сочетании с ее образованием и ресурсами, доступными ей в UH, предоставили ей возможность представлять Соединенные Штаты за рубежом в качестве сотрудника дипломатической службы.

Ее приняли в У.Престижная программа подготовки дипломатов Государственного департамента США в 2012 году переехала в Вашингтон. D.C. во время зимних каникул, чтобы начать программу подготовки дипломатов. Когда ее обучение будет завершено, она узнает, в какую часть света ее отправит Госдепартамент.

Немногие, гордые

Перед тем, как быть принятым на курс подготовки офицеров дипломатической службы, доктор Коффи - и тысячи других кандидатов на программу офицеров дипломатической службы Государственного департамента - прошли месяцы интенсивных тестов, собеседований и оценок.

«Каждый год около 25 000 человек проходят первоначальный тест», - сказала Донна М. Блэр, дипломат-резидент Хьюстонского университета. «Из них 40% могут пройти тест. Из оставшейся группы 10-15% переходят на следующую стадию, и менее 5% из них переходят на заключительную стадию ».

Многие люди повторно подают заявки на участие в программе в течение нескольких лет, но доктора Коффи наняли после первой попытки.

«Это был один из самых быстрых изменений, которые я когда-либо видел», - сказал Блэр.«У нее все хорошо, и я очень рад за нее. Она будет отличным дополнением к дипломатической службе.

Блэр не понаслышке знает, что нужно, чтобы стать офицером дипломатической службы, и она также лично знакома с сопутствующими опасностями.

Она проработала на дипломатической службе более 25 лет по всему миру. В 1998 году она потеряла хорошего друга и профессионального наставника, когда посольство США в Найроби, Кения, подверглось бомбардировке.

Сегодня, будучи дипломатом-резидентом Департамента политических наук, Блэр является представителем США в Юго-Восточном Техасе / Луизиане.С. Государственный департамент.

Одна из обязанностей Блэра - давать советы и рекомендации студентам, профессионалам и общественности по вопросам карьеры в Государственном департаменте. По ее оценкам, в настоящее время она помогает примерно 12 студентам, которые на каком-то этапе находятся в процессе подачи заявления на дипломатическую службу из района Хьюстона.

«Кандидаты на участие в программе знают, что эта работа имеет высокую награду, сложные задачи и высокий риск», - сказал Блэр. «Однако безопасность всегда является приоритетом номер один.”

Как только Блэр узнала, что Коффи был принят на программу обучения, она пригласила Коффи посетить мероприятия, где Блер могла начать знакомить ее с международными высокопоставленными лицами, приезжающими в Хьюстон из-за границы.

Это дало Коффи первое знакомство с жизнью в качестве сотрудника дипломатической службы и возможность встретиться с послом США в Нигерии во время одного из таких мероприятий.

Международные корни

Путешествие Коффи в Вашингтон фактически началось через Атлантический океан в ее родной Чехии.

В 2001 году она получила степень бакалавра делового права, а в 2003 году - степень магистра экономики (по специальности "Международные отношения и дипломатия" и "журналистика") в Экономическом университете в Праге.

В 2002 году она встретила своего мужа Бернарда, бывшего морского пехотинца США, который заканчивал степень магистра в Праге после восьми лет военной службы. Пара несколько лет жила и работала в Праге, прежде чем переехать в США.

Семья Коффи переехала в Сиэтл, где Коффи работала в Waggener Edstrom Worldwide, агентстве по связям с общественностью, где она занималась коммуникациями в кризисных ситуациях и другими связями с общественностью для Microsoft.

Когда работа ее мужа переехала в Хьюстон, она подала заявление в аспирантуру UH.

«Я решил поступить в Хьюстонский университет, потому что был впечатлен школьной программой сравнительной политики, а также программами по методам исследования и американской политике, которые являются моими второстепенными областями», - сказал Коффи. «Мне также понравилось разнообразие и разный опыт аспирантов UH - были студенты из Турции, Польши, Китая, Албании, Египта, Украины, Колумбии, Венесуэлы и т. Д.Мне понравилось учиться и работать со всеми из них ».

Коффи получила докторскую степень в декабре 2012 года под руководством Джима Гранато, профессора политологии и директора Центра общественной политики UH Hobby.

«С момента своего прибытия в UH Ева преуспела», - сказал Гранато. «Она была нацелена на то, чтобы быть очень конкурентоспособной на академическом рынке труда и получить постоянную должность в исследовательском отделе. Но у таких талантливых людей, как Ева, есть варианты. Она выбрала дипломатическую службу своим призванием и, несомненно, добьется успеха.Ее трудовая этика, интеллектуальный потенциал, навыки работы с людьми и образование в области социальных наук делают ее огромной силой для позитивных изменений ».

Во время пяти-шести недель обучения в Вашингтоне, округ Колумбия, Коффи узнала о внутренней работе Государственного департамента США, жизни в посольстве США и другой информации, относящейся к ее новой должности. После начальной программы обучения она получила более специализированное обучение, основанное на потребностях Государственного департамента того времени.

«Моя карьера на дипломатической службе - это общественная дипломатия, которая, по сути, занимается связями с общественностью от имени Соединенных Штатов», - сказал Коффи.

По завершении всех тренировок Коффи будет вручен флаг страны, в которой она будет назначена. В настоящее время в США 265 посольств, консульств и других дипломатических миссий по всему миру.

Хотя она надеется служить в посткоммунистической стране, такой как ее родная Чехия, она подписала соглашение о том, что она открыта для переезда в любую точку планеты. И она, и ее муж немного кочуют и с нетерпением ждут этой новой главы в своей жизни.

«Мы предприимчивы и не любим слишком долго жить в одном месте», - сказал Коффи. «Служить Соединенным Штатам в этом качестве для меня большая честь».

- Моника Байарс,

Bio Box для EvaCoffey:
Родился: 22 августа в Чехии.
Замужем: Бернар Д. Коффи, 21 мая 2005 г.
Знание языков: свободно владеет английским, чешским, словацким языками; продвинутый по немецкому языку; средний уровень по французскому, русскому языкам; новичок в испанском языке
Доктор политических наук, Университет Хьюстона, декабрь 2012 г.

Стратегия объединенного тестирования для выявления SARS-CoV-2 при низкой распространенности

Дизайн обсервационного исследования

Мы провели эксперимент, чтобы оценить гипотезу о том, что известный SARS- Положительные на CoV-2 образцы мазков из ротоглотки, собранные во время эпиднадзора на COVID-19 в Руанде, будут иметь положительный результат после того, как их объединят с 99 известными образцами, отрицательными на SARS-CoV-2.За этим последовало обсервационное исследование, целью которого было применение нашего алгоритма гиперкуба для повышения эффективности тестирования сообщества на COVID-19 в Руанде. В ходе эксперимента два разных набора пулов образцов были протестированы на SARS-CoV-2 с помощью ОТ-ПЦР. Каждый набор состоял из трех пулов образцов, которые содержали один известный SARS-CoV-2-положительный образец, разбавленный в соотношении 1:20, 1:50 и 1: 100 путем объединения его с эквивалентными количествами 19, 49 и 99 известных SARS-CoV. -2-отрицательные пробы соответственно (рис.2 и Таблица расширенных данных 2). В ходе наблюдательного исследования 1 280 человек, отобранных из сообщества, были протестированы на SARS-CoV-2 с помощью ОТ-ПЦР. Треть пациентов были участниками скрининга на предмет тяжелых острых респираторных инфекций и гриппоподобных заболеваний, который проводился в 30% медицинских учреждений в 30 округах Руанды. Остальные две трети были получены в результате скрининга на COVID-19 групп риска в столице Кигали. Последняя группа состояла в основном из физических лиц (продавцы на рынке, банковские агенты и агенты супермаркетов), которые оставались активными во время блокировки, введенной правительством Руанды для сдерживания COVID-19.Расширенные данные Таблица 1 суммирует характеристики участников исследования.

Положительная доля тестов ОТ-ПЦР на SARS-CoV-2, проведенных в Руанде в марте 2020 года, предполагает верхний предел в 2% для распространенности вируса в стране. Использование p = 2% в алгоритме гиперкуба указывает на оптимальный размер группы выборки 17,5. Для удобства 1 280 отдельных образцов были объединены в 64 группы по 20 образцов перед тестированием на SARS-CoV-2 (расширенные данные, рис. 1).

Мы использовали два установленных экспериментальных протокола для тестирования SARS-CoV-2.Первый - это протокол DAAN Gene и Университета Сунь Ятсена, доступный в Интернете (https://prolabcorp.com/daan-rt-pcr-reagent-set-for-covid-19-real-time-detection-for -48-samples-research-use-only), а также находится на рассмотрении ВОЗ. Второй протокол 13 широко используется научным сообществом. Первый протокол используется для рутинного скрининга на SARS-CoV-2, тогда как второй протокол используется только в том случае, если первый протокол дает положительный результат и поэтому требуется подтверждение.

Сбор образцов и дизайн пула

Мазки из ротоглотки собирали, протирая миндалины и заднюю стенку глотки двумя тампонами, а головки тампонов погружали в 3 мл вирусной транспортной среды. Образцы были доставлены в вирусной транспортной среде в Национальную справочную лабораторию Руанды сразу после сбора. Образцы, которые необходимо было транспортировать на большие расстояния, хранили в сухом льду. Каждый образец имел объем 3 мл, из которых аликвоту 200 мкл использовали для объединенного тестирования, а оставшуюся часть временно хранили при -20 ° C до тех пор, пока не стал известен результат объединенного тестирования.Аликвоту (200 мкл) каждого образца смешивали с аликвотами с таким же объемом других образцов того же пула в конической пробирке Falcon на 15 мл, и после встряхивания в течение 5 с пипеткой вносили 200 мкл смеси для последующей РНК. добыча. Затем 5 мкл экстрагированной РНК добавляли к 20 мкл мастер-микса, чтобы получить в общей сложности 25 мкл для амплификации с помощью ОТ-ПЦР. Если пул дал положительный результат, сохраненные образцы из этого пула обрабатывались для определения положительных образцов. На отдельные образцы был нанесен штрих-код, что упрощало отслеживание лиц, у которых был положительный результат, и сводил к минимуму риск смешения образцов.Дизайн бассейна и последующий экспериментальный анализ (см. «ОТ-ПЦР для SARS-CoV-2») были реализованы с помощью робота, чтобы уменьшить человеческую ошибку.


Полную вирусную РНК экстрагировали из образцов мазков с использованием мини-набора QIAamp Viral RNA 91 (QIAGEN) в соответствии с инструкциями производителя. Образцы РНК были проверены на SARS-CoV-2 с использованием теста RT-PCR 2019-nCoV RNA, который нацелен на два гена, которые, соответственно, кодируют открытую рамку считывания (обозначается orf1ab) и белок нуклеокапсида (обозначается N) (DAAN Gene и Sun Ят-сена).Для orf1ab в качестве прямого и обратного праймеров использовали CCCTGTGGGTTTTACACTTAA и ACGATTGTGCATCAGCTGA, соответственно, вместе с зондом 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 '. Для N в качестве прямого и обратного праймеров использовали GGGGAACTTCTCCTGCTAGAAT и CAGACATTTTGCTCTCAAGCTG, соответственно, вместе с зондом 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 '. Реакция RT-PCR была настроена согласно протоколу производителя, с общим объемом 25 мкл. Реакцию проводили на приборе ABI Prism 7500 SDS (Applied Biosystems) при 50 ° C в течение 15 минут для обратной транскрипции, денатурировали при 95 ° C в течение 15 минут, а затем проводили 45 циклов ПЦР при 94 ° C в течение 15 с и 55 ° C. C в течение 45 с.Пороговый цикл (C t ) ≤ 40 указывает на положительный результат теста; C t > 40 свидетельствует об отрицательном результате. Положительные контроли для реакции показали амплификацию, как определено кривыми для каналов обнаружения FAM и VIC, и C t ≤ 32. Положительные тесты были подтверждены с использованием LightMix SarbecoV E-gene и LightMix Modular SARS-CoV-2 RdRp RT – PCR тесты, нацеленные на гены оболочки (E) и РНК-направленной РНК-полимеразы (rdrp), соответственно, как описано производителем (TIB MOLBIOL).{\ ast} \) является подходящим квантилем t-распределения Стьюдента с n - 1 степенями свободы (ф.р.). Доверительная граница для суммы средних значений двух выборок значений C t размеров n 1 и n 2 , соответственно, была рассчитана по той же формуле с \ ({\ bar {C}} _ {{\ rm {t}}} \) установлен равным сумме индивидуальных выборочных средних, s установлен равным сумме стандартных ошибок индивидуальных выборочных средних и df установить меньшее из n 1 - 1 и n 2 - 1.Статистический анализ проводился с использованием среды статистических вычислений R (https://www.r-project.org/).

Потеря чувствительности из-за разбавления

Для оценки чувствительности после разбавления тестов ОТ-ПЦР с различным максимальным количеством циклов ПЦР мы объединили два набора данных. Во-первых, мы использовали среднее и стандартное отклонения количества дополнительных циклов ПЦР, необходимых для положительного обнаружения, после k-кратного разведения положительного образца (рис. 2, показывающий данные в таблице расширенных данных 3).Во-вторых, мы использовали среднее значение и стандартное отклонение значений C t для положительных образцов, взятых из целевой популяции. Мы объединили (или, точнее, свернули) два распределения вероятностей, представленные как гауссианы, чтобы вычислить чувствительность теста ПЦР с циклом ≤x как вероятность того, что значение C t для k-кратно разведенного положительного образца, взятого из такая же популяция будет ≤x. Используя репрезентативную выборку из 33 положительных образцов, выявленных в ходе клинического скрининга на SARS-CoV-2 в Руанде (расширенная таблица данных 3), мы оцениваем, что тест ПЦР с периодом ≤40 циклов, нацеленный на ген SARS-CoV-2 N (или orf1ab) соответственно, имеет чувствительность после разбавления для 20-, 50- и 100-кратных разведений 95%, 92% и 89% (или 86%, 82% и 77% соответственно).Для теста ПЦР с периодом ≤44, нацеленного на ген N (или orf1ab), мы получаем чувствительность после разбавления для 20-, 50- и 100-кратных разведений 99%, 98% и 98% (или 96%, 94 и 92%). ), соответственно. Как упоминалось в документе, в недавнем исследовании объединенного тестирования на SARS-CoV-2 в Израиле 10 было использовано максимум 44 цикла ПЦР.

В качестве дальнейших проверок мы применили тот же анализ к (1) независимой выборке из 107 положительных образцов, собранных в Руанде, и (2) ранее опубликованному набору данных 10 , который состоит из 26 положительных образцов, выявленных в предыдущем исследовании 10 .На основе набора данных из Руанды мы подсчитали, что 40-цикловая ПЦР-тест, нацеленная на ген N (или orf1ab), соответственно, имеет чувствительность после разбавления для 20-, 50- и 100-кратных разведений 91%, 88% и 85% (или 85%, 81 и 77% соответственно). Для 44-цикла ПЦР-теста, нацеленного на ген N (или orf1ab), соответственно, прогнозируемая чувствительность составляет 97%, 96% и 95% (или 94%, 92 и 90%). Ранее опубликованный набор данных 10 содержит значения C t только для одного гена - гена E SARS-CoV-2.На основании аргументов, описанных выше, для простоты мы предполагаем, что разбавление положительного образца в 20, 50 и 100 раз добавляет примерно 5, 6 и 7, соответственно, к исходному значению C t . Применяя эти предположения к ранее опубликованному набору данных 10 , мы делаем вывод о чувствительности после разбавления для 20-, 50- и 100-кратных разведений 94%, 92% и 89% соответственно для теста ПЦР с периодом ≤40 и 99%. %, 98% и 97% для теста ПЦР с периодом ≤44. Эти результаты сопоставимы с результатами наших экспериментов.В совокупности эти результаты подтверждают, что разбавление положительных образцов действительно приводит к потере чувствительности, но большая часть потерь может быть компенсирована увеличением количества циклов ПЦР. В частности, чувствительность выше 90% может быть достигнута для 100-кратного разведения с помощью 44 циклов ПЦР, что всего на 10% больше, чем обычно используется.

Одобрение этики

Утверждение этики было получено от Национального комитета по этике Руанды (FWA Assurance No. 00001973 IRB 00001497 от IORG0001100 / 20 марта 3020), и от участников было получено письменное информированное согласие.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этим документом.

Eva et al. Провалить тест на честность

В эпоху до появления Common Core у нас была большая проблема. Большинство государственных тестов измеряли минимальную компетентность в чтении и математике. Но мы не смогли сообщить об этом родителям, поэтому они разумно думали, что проходной балл означает, что их ребенок в значительной степени там, где они должны быть. Мало ли они знали, что их ребенок может заработать отметку «уровень мастерства» и будет читать или заниматься математикой на двадцатом или тридцатом процентиле в национальном масштабе.Откровенно говоря, мы солгали родителям слишком многих детей, которые были намного ниже среднего и совсем не на пути к успеху в колледже или к хорошо оплачиваемой карьере.

Игра в игры со сниженным уровнем владения языком во многом послужила толчком для создания Common Core. Штаты повысили стандарты и начали проводить испытания на гораздо более высоком уровне. Большинство штатов проводят эти тесты впервые прямо сейчас, хотя Нью-Йорк и Кентукки сделали переход два года назад. Согласно новому анализу, проведенному Полом Петерсоном и Мэтью Акерманом в «Education Next», по состоянию на 2013 год тесты Нью-Йорка были самыми сложными в стране, соответствуя - если не превышая - стандартам результатов Национальной оценки успеваемости.

Это может решить проблему «иллюзии умения». Но теперь у нас появилась новая проблема. Некоторые реформаторы образования и средства массовой информации уже используют результаты новых, более жестких тестов, чтобы маркировать школы как «неуспевающие», если большинство их учеников не соответствуют более высоким стандартам. Обратите внимание, например, на специальный репортаж Daily News «Сражайтесь за свое будущее», который начинается с провокационного заголовка «Нью-Йорк изобилует школами с низким уровнем успеваемости, в том числе почти две трети учащихся не соответствуют стандартам штата.Эта линия нападок очень напоминает тезисы Евы Московиц и Джереми Киттридж из организации «Семьи для отличных школ», которые продвигают идею о том, что в Нью-Йорке «800 000 детей не умеют читать или заниматься математикой на уровне своего класса» и «143 000 детей. застряли в школах, которые постоянно терпят неудачу ».

Эти заявления выходят за рамки, и реформаторы должны так сказать. Они подтверждают опасения, которые некоторые преподаватели высказывали все время: мы будем использовать результаты более жестких тестов, чтобы несправедливо квалифицировать большее количество школ как неуспешные.


Позвольте мне прояснить: я не против называть школы "постоянно терпящими неудачу". Такие школы существуют, и они должны подвергаться агрессивному вмешательству, включая закрытие. И я был бы счастлив, если бы их заменили высокоэффективные хартии вроде Eva’s Success Academies. Но, как я доказывал до тошноты (и Мэтью Ди Карло из Института Шанкера терпеливо и убедительно объяснял в течение многих лет), оценивать школы только на основе уровня знаний - плохая математика. (Московитц и Киттредж определяют «школу, которая постоянно терпит неудачи», как школу, в которой 10 процентов или меньше учащихся владеют навыками чтения и математики, или, в случае средней школы, где такой же или меньший процент учащихся проходит тестирование в колледже. уровни.)

Это потому, что проходные баллы имеют такое же отношение к успеваемости учащихся, когда они поступают в школу, а также к объему обучения, которое происходит, когда они туда поступают. В частности, в сценарии с высокими стандартами школы вполне могут помочь учащимся значительно развиваться, но при этом не достичь «уровня мастерства». Ужасно смотреть только на годовые показатели успеваемости, а не на то, с чего начинают ученики. Это особенно актуально для средних и старших классов, в которые учащиеся могут поступать на четыре года и более позже.Существует нетривиальный риск провалиться в некоторых школах, которые, несмотря на низкие оценки, на самом деле поступают правильно со стороны детей.

Всем семьям для отличных школ нужно искать школы с низким уровнем образования и высокими темпами роста. Наверное, их не так уж и много. Но вычитание их из уравнения «неуспевающих школ» будет иметь большое значение для демонстрации педагогам, что мы не играем в пустяки.


А как насчет утверждения Daily News о том, что «почти две трети студентов» «не соответствуют государственным стандартам»? Это правда, но этого также следовало ожидать.Нью-Йорк установил свой сокращенный балл в соответствии со своим определением «готовности к колледжу и карьере». Результатом этого процесса был сокращенный балл, определяющий уровень владения языком примерно на уровне семидесятого процентиля. Это может показаться завышенным, но это имеет смысл, потому что мы знаем из показателей NAEP, ACT, SAT и исправлений в колледжах, что только около 30 процентов выпускников средних школ действительно готовы к поступлению в колледж, что определяется как возможность приехать в университетский городок и добиться успеха. -курсы родов с первого дня. (У нас меньше информации о том, сколько из них готовы к карьере, хотя если мы говорим о карьере, требующей каких-либо технических навыков или повышения квалификации, то, вероятно, в том же диапазоне.) Следовательно, большинство детей ниже семидесятого процентиля по математике или чтению, вероятно, не на пути к учебе в колледже или устойчивой, хорошо оплачиваемой карьере.

Есть надежда, что со временем больше учеников достигнут стандартов, поскольку школы повышают ожидания и улучшают преподавание и обучение. (Другими словами, мы сдвинем колоколообразную кривую вправо.) И в результате больше студентов будут готовы к колледжу и карьере после окончания средней школы. Но это не произойдет в одночасье.


Переход к более высоким стандартам означает, что нам необходимо пересмотреть нашу риторику и, что более важно, наш подход к подотчетности школы.В те времена, когда были низкие стандарты, было совершенно законным вызывать школы, которые не могли довести всех или большинство своих учеников до минимального уровня грамотности и счета. Ничего не получится и в том, чтобы так же очернить школы, которые не позволяют всем своим ученикам «поступить в колледж и сделать карьеру». Это гораздо более высокая планка и гораздо более длинная дорога.

Утопично думать, что большинство американских детей сразу овладеют стандартами Common Core. Было бы пораженчеством думать, что школы ничего не могут сделать, чтобы помочь своим ученикам продвинуться к этой благородной цели.И неискренне занимать любую из этих крайних позиций в этой дискуссии.

- Майк Петрилли

Это впервые появилось на липкой бумаге.

Системные архивы

EVA | MobileODT

Дэвид Левитц | 21 мая 2020 г. | Медицинское исследование

, представленное на ежегодных научных сессиях ASCCP 2020 г. Выполнение автоматизированной визуальной оценки в качестве сортировочного теста для пациентов с ВПЧ + из скринингового лагеря в сельском Китае от MobileODT М. Кремер (1) (, 4), AT Goldstein (2), Р. Ниссим (3), И Мисрахи (3), С. Беделл (2), С...

Дэвид Левитц | 21 мая 2020 г. | Медицинское исследование

, представленное на ежегодных научных сессиях ASCCP 2020 г. Выполнение автоматизированной визуальной оценки в качестве критерия сортировки для пациентов с ВПЧ + из скринингового лагеря в сельском Китае от MobileODT AT Goldstein (1), С. Беделл (1), Р. Липсон (2), CM Sebag (3), L Lobel (3), D Levitz ...

Дэвид Левитц | 21 мая 2020 г. | Медицинское исследование

, представленное на ежегодных научных сессиях ASCCP 2020 Влияние устройства на точность классификатора машинного обучения при обнаружении дисплазии шейки матки с помощью MobileODT KC Fernandes (1), T. Freitas (1), Y Zall (2), R Nissim (2), D Levitz (2) (1) НИЛЬГ.ai, Порту, Португалия (2) ...

Рэйчел Гросс | 26 февр.2020 г. | Блог

Хотя врачи стремятся предоставлять наилучшие возможные услуги, акушеры по всему миру продолжают сталкиваться с широко распространенными препятствиями в предоставлении лечения. Мы поговорили с международными экспертами, чтобы услышать их мнение о пяти самых серьезных проблемах, с которыми сталкиваются OBGYN во всем мире. 1. Страх ...

Рэйчел Гросс | 17 февр.2019 г. | Блог

До 35% времени врача тратится на ведение заметок.Это ценное время, которое можно было бы лучше использовать, если бы были найдены более эффективные методы ведения документации и сбора данных. MobileODT взял на себя задачу уменьшить бремя ведения заметок для ...

от MobileODT | 11 янв.2019 г. | Пресс-релизы

MobileODT первой разработала коммерческое приложение для алгоритма машинного обучения AVE для обнаружения рака шейки матки 11 января 2019 г. - Тель-Авив - Новый алгоритм с расширенным интеллектом (AI) может обнаруживать рак шейки матки на основе одного изображения....

от MobileODT | 02 янв.2019 г. | Блог

2018 год стал годом удивительных возможностей для MobileODT, чтобы помочь поставщикам здравоохранения заботиться о женщинах во всем мире. Для нас большая честь участвовать в значительных успехах, достигнутых с использованием нашей системы EVA во всех наших ключевых областях кольпоскопии, SANE, глобального здравоохранения и ...

Рэйчел Гросс | 10 дек.2018 г. | Блог

Мы поговорили с доктором Збигневом Врубелем, директором клиники акушерства и гинекологии Medi-Lab в Свиднице, Польша, о том, как эта область развивается в Польше.Как польские медики отреагировали на тенденцию к эстетической гинекологии? В этом году увидели .