Бифидобактерии для новорожденных инструкция по применению: (Bifidumbacterin siccum), , , , , 10

Примадофилус детский для детей от 0 лет

1

А.В. Чаплин, Л.И. Кафарская и соавт. Изучение видового разнообразия бактерий рода
Bifidobacterium кишечной микрофлоры с использованием метода MALDI-TOF
масс-спектрометрии. АКТУАЛЬНЫЕ ВОПРОСЫ МИКРОБИОЛОГИИ. ВЕСТНИК РАМН/2015/ 70 (4).

2

Underwood MA et al. Bifidobacterium longum subspecies infantis: champion colonizer
of the infant gut. Pediatr Res. 2015 January.

3

Мухина Ю.Г., Шумилов П.В., Дубровская М.И., Ипатова М.Г. Синдром персистирующих
диарей у детей. //Эффективная Фармакотерапия. Гастроэнтерология 3/2011.

4

European Society for Padiatric Gastroenterology, Hepatology and Nutrition/European
Society for Pediatric Infection Diseases. Evidence-based guidelines for the
management of acute gastroenteritis in children in Europe. J. Pediatric Gstroenter.
Nutr.2008; 46 (Suppl.2).

5

«Особенности течения и лечения ротавирусной инфекции у детей»// В. Н. Тимченко, Е.
Б. Павлова, М. Д. Субботина, ЛЕЧАЩИЙ ВРАЧ, СЕНТЯБРЬ 2011, № 8

6

L.M. Foster, T.A. Tompkins and W.J. Dahl (2011). A comprehensive post-market review
of studies on a probiotic product containing Lactobacillus helveticus R0052 and
Lactobacillus rhamnosus R0011. Beneficial Microbes, December 2011; 2(4).

7

Engelbrektson, A., et al. (2009). «Probiotics to minimize the disruption of faecal
microbiota in healthy subjects undergoing antibiotic therapy.» J Med Microbiol 58(Pt
5): 663-670.

8

Beausoleil, M., et al. (2007). «Effect of a fermented milk combining Lactobacillus
acidophilus Cl1285 and Lactobacillus casei in the prevention of
antibiotic-associated diarrhea: a randomized, double-blind, placebo-controlled
trial.» Can J Gastroenterol 21(11): 732-736.

9

Lallemand Internal Report.

10

«Восстановление микробиоценоза кишечника в комплексной терапии атопического
дерматита у детей»// Мельникова И. Ю., Горюнова М.М.,Самсонова М.В. // «Вопросы
современной педиатрии», № 4 за 2007

11

Follad N. et al. Effect of nutrient supplementation on atopic dermatitis in
children: A systematic review of probiotics, prebiotics, formula, and fatty acids.
JAMA Dermatol. 2013; 149(3):350-5.

12

Vanessa Levin-Le Moal et al. Anti-Infective Activities of Lactobacillus Strains in
the Human Intestinal Microbiota: from Probiotics to Gastrointestinal Anti-Infectious
BiotherapeuticAgents. Clinical Microbiology Reviews 2014; 27(2):167-199.

13

Cazzola et al. (2010b) Efficacy of a synbiotic supplementation in the prevention of
common winter diseases in children: a randomized, double-
blind, placebo-controlled pilot study. Ther Adv Respir Dis 2010b, 4(5).

Израильские ученые: пробиотики не несут практически никакой пользы

  • Джеймс Галлахер
  • Обозреватель Би-би-си по вопросам науки

Автор фото, Getty Images

Группа израильских ученых пришла к выводу, что продукты, обогащенные пробиотиками — биологически активными добавками, содержащими живые микрокультуры, — на самом деле практически бесполезны.

Они провели одно из наиболее детальных исследований того, что происходит с организмом человека при употреблении пробиотиков.

Широко рекламируемые пробиотики считаются полезными для желудочно-кишечного тракта, но результаты исследования показали, что они либо оказывают слабый эффект на организм, либо вообще никакого.

Исследователи пришли к выводу, что в будущем пробиотики нужно будет адаптировать к потребностям конкретного потребителя.

Команда ученых из Института имени Вейцмана составила коктейль из пробиотиков, использовав 11 бактерий, включая лактобациллы и бифидобактерии. Полученный коктейль давали 25 добровольцам на протяжении месяца.

Затем у участников экспериментов под наркозом взяли пробы из различных участков желудка, а также толстого и тонкого кишечника.

Ученые проверяли, где бактерии успешно образовали колонии, и привело ли это к каким-либо изменениям в активности кишечника.

Результаты, опубликованные в журнале Cell, показывают, что в половине случаев поступившие в организм с пищей полезные бактерии незамедлительно покинули его естественным путем.

В остальных случаях они задерживались в организме ненадолго.

Человек и микробы

  • Мы в большей степени микробы, нежели люди; если посчитать все клетки в теле человека, то окажется, что лишь 43% из них — человеческие
  • Остальное — это микробиом человека, который включает бактерии, вирусы, грибы и одноклеточные археи
  • Геном человека состоит из 20 тысяч генов
  • Если сложить вместе все гены, составляющие микробиом человека, получится число в диапазоне от 2 млн до 20 млн
  • Это — так называемый второй геном, и от него зависит склонность к болезням, включая аллергии, ожирение, воспаление кишечника, болезнь Паркинсона. Также он влияет на усвоение противораковых препаратов, на развитие депрессии и возникновение аутизма

Стенки кишечника служат домом для триллионов бактерий, и у каждого человека их набор уникален.

По словам профессора Эрана Элинава, было бы ошибкой надеяться, что «универсальные» пробиотики окажутся одинаково эффективны для всех.

«В этом смысле покупка пробиотиков в супермаркете — без индивидуализации, без адаптации к потребностям организма-хозяина или хотя бы части популяции, довольно бессмысленна», — говорит ученый.

Исследователи также провели эксперимент с воздействием пробиотиков на организм после приема курса антибиотиков, которые убивают как полезные, так и вредные бактерии.

Результаты эксперимента показали, что в таких случаях возникают задержки в восстановлении здоровых бактерий.

«Вопреки устоявшемуся мнению, что пробиотики безвредны, эксперимент выявил новый потенциальный побочный эффект употребления пробиотиков с антибиотиками, который может иметь долгосрочные последствия», — говорит Элинав.

В то же время доказана польза пробиотиков в некоторых случаях: например, они способствуют защите недоношенных детей от некротизирующего энтероколита.

И это дает поле для надежды на то, что понимание сложных взаимоотношений микробиома с человеческим организмом позволит разработать новые методики лечения болезней.

Профессор Тревор Лоули из британского Института Сенгера не удивлен результатами исследования своих израильских коллег.

«Пробиотики открыты уже давно, и они подвергаются все более скрупулезному анализу. Эти исследования — новаторские, и их результаты требуют подтверждения. У кишечника есть естественное свойство блокировать образование колоний бактерий, и мы должны найти способ обойти это», — говорит ученый.

Бифидумбактерин для новорожденных: инструкция по применению

Желудочно-кишечный тракт недавно рождённого ребёнка ещё не полностью сформирован, а поэтому он работает со сбоями. Речь идёт о знакомых всем мамам неприятных явлениях: срыгивание, метеоризм, колики, понос, боль в животе и т. д. Они делают младенца беспокойным, капризным, вызывают расстройства сна. Чтобы устранить неприятные симптомы рекомендуется использовать специальные лекарственные средства – пробиотики. Они нормализуют микробную флору кишечника, функциональность пищеварительного тракта.

Бифидумбактерин – это пробиотический препарат на основе бифидобактерий (в высушенном виде), который налаживает работу кишечника. Медикамент применяют для лечения детей при сильных расстройствах пищеварения, для профилактики рахита, совместно с другими препаратами для лечения малокровия, диатеза. Бифидумбактерин нормализует пищеварение, восполняет дефицит полезных микроорганизмов в кишечнике, повышает иммунитет.

Расстройства пищеварения у грудничков

После рождения пищеварительный тракт ребёнка стерильный, при попадании в новую среду он заселятся разнообразными микроорганизмами (полезными, условно-патогенными). Именно болезнетворные бактерии провоцируют расстройства пищеварения из-за неправильного расщепления грудного молока (детского молочного питания). Это нарушение у младенцев проявляется коликами, избыточным скоплением газов, частыми и обильными срыгиваниями. Из-за этого ухудшается сон, новорождённый медленно набирает вес.

Во многих случаях пищеварительный тракт без помощи медикаментов адаптируется к новым условиям, и все симптомы дисбиоза (нарушение бактериальной флоры) исчезают к 3 месяцам. Если же этого не случилось, нужно помочь грудничку преодолеть трудный период. Важно наполнить кишечник бифидобактериями, которые содержатся в препарате Бифидумбактерин. После проникновения в пищеварительный тракт микроорганизмы активно размножаются, останавливают развитие условно-патогенных бактерий.

Основные сведения

Бифидумбактерин является представителем эубиотиков (пробиотиков). Бифидобактерии, которые являются основным компонентом препарата, выращены на специальной питательной среде. После попадания в пищеварительный тракт они активно размножаются. Полезные микроорганизмы стимулируют функциональность ЖКТ, нормализуют пищеварение, метаболизм, синтез полезных веществ. Кроме того, препарат повышает защитные силы организма, ускоряет выход токсических веществ.

Пробиотик эффективен по отношению ко многим вредоносным микроорганизмам: энтеропатогенной кишечной палочке, протею, стафилококкам, некоторым штаммам дрожжеподобных грибов.

Существуют разные лекарственные формы эубиотика: сухой Бифидумбактерин в ампулах, в порошке (пакеты из фольги), а также капсулы и вагинальные суппозитории.

Сухой препарат упакованный в ампулы и флаконы создан методом лиофильной сушки, то есть живые микроорганизмы сначала заморозили, а потом высушили. Содержание бифидобактерий в 1 дозе пробиотика составляет 107КОЕ, кроме того, препарат содержит молочно-сахаро-желатиновую среду, на которой выращены микроорганизмы.

Порошок содержит 108 КОЕ живых бактерий, которые очищены от питательной среды. В Бифидумбактерин форте живая микробная масса составляет 107 КОЕ, бифидобактерии сорбированы на частичках активированного угля и смешаны с лактозой.

Благодаря тому, что микроорганизмы неподвижны, пробиотик осуществляет локальную колонизацию внутренних оболочек кишечника, как следствие, быстрее восстанавливается естественная бактериальная флора. Форма выпуска Бифидумбактерина форте – порошок, капсулы, которые содержат по 5 доз бифидобактерий.

Назначение препарата

Бифидумбактерин назначают новорождённому в следующих случаях:

  • Нарушение микробной флоры кишечника после приёма гормональных, антибактериальных, противоопухолевых препаратов, НПВС.
  • Дисбиоз после стрессов.
  • Дисбактериоз на фоне заболеваний пищеварительной системы (воспаление желчного пузыря, поджелудочной железы, язва желудка и 12-перстной кишки и т. д.).
  • Нарушение микрофлоры при урогенитальных инфекциях, воспалении бронхов и лёгких.
  • Инфекционные заболевания кишечника с острым течением (ротавирусный гастроэнтерит, стафилококковая пищевая токсикоинфекция, кишечная инфекция, вызванная сальмонеллами и т. д. ).
  • Инфекционные заболевания кишечника не выясненного происхождения.
  • Синдром недостаточности всасывания.
  • Запоры с хроническим течением.
  • Дисбактериоз влагалища, вагинит бактериального происхождения.
  • Патологии пищеварительных органов (печень, кишечник, поджелудочная железа) – восстановление естественной микрофлоры перед операцией.
  • Аллергия, которая сопровождается дисбиозом.

Бифидумбактерин применяют для новорождённых, которые употребляют искусственные смеси или донорское молоко для нормализации микрофлоры. Кроме того, препарат эффективен для профилактики воспаления молочных желез у кормящих мам.

Применение и дозировка

Способ применения пробиотика: пероральный, ректальный, вагинальный. Для детей применяют оральные формы препарата.

Многие родители ищут ответ на вопрос о том, как разводить Бифидумбактерин для новорожденных. Для этого нужно пакетик с порошком вскрыть, развести его тёплой жидкостью (грудное молоко или остывшая кипячёная вода). Одну дозу порошка разводят в 30 мл жидкости. Если ребёнок не выпивает всю порцию раствора, то рекомендуется использовать меньше жидкости. Важно следить за температурой, она должна быть тёплой, при 40° живые микроорганизмы погибают. Раствор дают младенцу за 30 минут до кормления.

Новорожденным дают исключительно свежее лекарство, хранить его запрещено. В сухом виде препарат можно держать на нижних полках холодильника (температура около 10°).

Суточная дозировка препарата для лечения новорожденных зависит от возраста и симптоматики:

  • 0 – 6 месяцев – 1 пакетик дважды или трижды на протяжении 2 – 3 дней, потом кратность применения увеличивают до 4 – 6 раз;
  • 6 месяцев – 3 года – 1 пакетик трижды или четырежды;
  • 3 – 7 лет – 1 пакетик от 3 до 5 раз;
  • От 7 лет и старше – 2 пакетика трижды или четырежды.

Терапевтический курс длится 3 – 4 дня, при инфекционных заболеваниях кишечника с острым течением – от 5 до 7 суток. После 2 – 3 курсов с перерывом в 4 недели достигается длительный положительный результат.

Дневная доза препарата для профилактики расстройств пищеварения:

  • 0 – 6 месяцев – 1 пакетик однократно;
  • 6 месяцев – 3 года – 1 пакет однократно или двукратно;
  • От 3 лет и старше – 2 пакетики 1 или 2 раза.

Профилактический приём длится 2 – 3 недели. Окончательную дозировку, схему лечения определит педиатр после осмотра ребёнка и установления диагноза.

Меры предосторожности

Обычно дети отлично переносят пробиотик, и побочные реакции после его приёма отсутствуют. Как гласит инструкция по применению, Бифидумбактерин противопоказан грудничкам только при повышенной чувствительности к его веществам (лактоза, крахмал, кальций стеариновокислый). Каждая мать должна знать, какие компоненты вызывают аллергию у её ребёнка, и согласно этой информации подбирать лекарственные средства. А ещё лучше доверить выбор педиатру.

При гиполактазии не рекомендуется принимать пробиотик в ампулах и флаконе. Эти средства содержат молочный сахар, а при недостатке или отсутствии лактазы (фермент, который расщепляет лактозу) повышается вероятность избыточного газообразования или коликов. Как предотвратить образование коликов и правильно их лечить, читайте в статье по ссылке https://vskormi.ru/problems-with-baby/problems-with-the-tummy/profilaktika-kolikov/.

Аналогичные препараты

При наличии аллергии на компоненты Бифидумбактерина или гиполактазии у грудничка препарат рекомендуется заменить на более безопасный. Фармацевтический рынок предлагает медикаменты с аналогичным действием:

  • Бифиформ;
  • Пробифор;
  • Бифинорм;
  • Биолакт и другие.

Это препараты на основе живых бифидобактерий, которые тормозят развитие болезнетворных микроорганизмов.

Многих родителей интересует вопрос о том, что лучше – Лактобактерин или Бифидумбактерин. Оба препарата являются пробиотиками на основе живых микроорганизмов. Только в составе Лактобактерина содержатся лактобактерии, а Бифидумбактерина – бифидобактерии. Действуют пробиотики практически одинаково, однако последний препарат чаще назначают детям грудного возраста, так как в их кишечнике больше бифидобактерий. Врач поможет выбрать подходящее лекарство, проконсультирует по вопросу приёма.

Согласно отзывам, Бифидумбактерин с пометкой «Форте» более эффективный, так как в его составе присутствуют бифидобактерии, адсорбированные на частичках активированного угля. Лекарственное средство проникает в пищеварительный тракт и быстрее проявляет терапевтический эффект.

Таким образом, Бифидумбактерин – это эффективное и безопасное пробиотическое средство, которое восстанавливает микробную флору кишечника, нормализует пищеварение, повышает иммунитет. Однако, во избежание негативных явлений перед применением препарата, тщательно изучите противопоказания. Бифидумбактерин противопоказан при аллергии на его компоненты и гиполактазии. Важно соблюдать дозировку и схему лечения, которую определил педиатр.

состав смеси, инструкция по применению

Состав:

обезжиренное молоко, лактоза, РАСТИТЕЛЬНЫЕ МАСЛА (высокоолеиновое подсолнечное масло, кокосовое масло, соевое масло), концентрат сывороточного белка, фруктоолигосахариды (ФОС), МИНЕРАЛЫ (калия цитрат, кальция карбонат, натрия цитрат, натрия хлорид, магния хлорид, железа (II) сульфат, цинка сульфат, кальциевые соли ортофосфорной кислоты, меди сульфат, марганца сульфат, йодид калия, селенит натрия), гидролизат сывороточного белка, арахидоновая кислота (АRA) из масла M.alpina, олигосахарид 2′-FL, ВИТАМИНЫ (витамин C, холин, ниацин, пантотеновая кислота, витамин А, витамин B1, витамин B6, фолиевая кислота, витамин К1, витамин B2, биотин, витамин D3, витамин В12), эмульгатор соевый лецитин, докозагексаеновая кислота (DHA) из масла C. cohnii, инозит, Bifidobacterium lactis (не менее 106 КОЕ/г), таурин, L-триптофан, НУКЛЕОТИДЫ (цитидин 5’-монофосфат, динатрия уридин 5’-монофосфат, аденозин 5’-монофосфат, динатрия гуанозин 5’-монофосфат), антиокислитель смесь токоферолов, L-карнитин, КАРОТИНОИДЫ (лютеин, бета-каротин).

ПИЩЕВАЯ ЦЕННОСТЬ

ПОКАЗАТЕЛИ

Единицы измерения

В 100 г

порошка

В 100 мл при стандартном  разведении1

Энергетическая ценность

ккал (кДж)

509 (2129)

64 (266)

Белки

г

10,6

1,33

Казеин/сывороточный белок

%

50/50

50/50

Жиры

г

26,3

3,29

  Линолевая кислота

мг/% от суммы жирных кислот

4500/18

563/18

  α-Линоленовая кислота

г

0,48

0,06

  Арахидоновая кислота (ARA)

мг

75

9

  Докозагексаеновая    кислота (DHA)

мг

38

5

Углеводы

г

56,54

7,07

   Лактоза

г

56

7

Пищевые волокна

г

1,76

0,22

  Фруктоолигосахариды

г

1,6

0,20

  Олигосахарид 2′-FL

мг

160

20

Карнитин

мг

7,5

0,9

Таурин

мг

30

3,8

Инозит

мг

78

9,8

ВИТАМИНЫ

Витамин A

мкг RE

453

57

Витамин D3

мкг

7,5

0,94

Витамин E

мг α- TE

6,0

0,8

Витамин К

мкг

45

5,6

Витамин С

мг

51

6,4

Витамин В1

мкг

500

63

Витамин В2

мкг

700

88

Ниацин

мкг

4500

563

Витамин В6

мкг

350

44

Фолиевая кислота

мкг

70

9

Витамин В12

мкг

1,0

0,13

Биотин

мкг

15,0

1,9

Пантотеновая кислота

мкг

2900

363

Холин

мг

50

6,3

МИНЕРАЛЫ

Натрий

мг

182

23

Калий

мг

510

64

Хлориды

мг

333

42

Кальций

мг

379

47

Фосфор

мг

226

28

Магний

мг

36

4,5

Железо

мг

6,2

0,78

Цинк

мг

4,10

0,51

Медь

мкг

350

44

Марганец

мкг

130

16

Селен

мкг

10

1,3

Йод

мкг

80

10

Нуклеотиды

мг

19,7

2,5

Бета-каротин

мкг

61

8

Лютеин

мкг

91

11

Осмоляльность

мОсм/кг

267

1Стандартное разведение: одна мерная ложка 4,2 г (прилагается) порошка без горки + 30 мл воды.

100 мл готовой к употреблению смеси Симилак Голд 1 = 12,5 г порошка + 90 мл воды

ДЕРОЛ КАПЛИ » Polski Lek S.A.

Пищевая добавка.
Суспензия
Продукт предназначен для младенцев, детей и взрослых.

Дерол® капли представляет собой препарат, содержащий один из наиболее известных и изученных штаммов — Saccharomyces boulardii (Сахаромицеты

 (…) подробнее

Пищевая добавка.
Суспензия
Продукт предназначен для младенцев, детей и взрослых.

Дерол® капли представляет собой препарат, содержащий один из наиболее известных и изученных штаммов — Saccharomyces boulardii (Сахаромицеты Буларди). Его эффективность и безопасность были подтверждены многими научными исследованиями с участием детей и взрослых.1-2

Saccharomyces boulardii завоевал доверие гастроэнтерологов, педиатров и неонатологов всего мира.

В настоящее время имеется весомая доказательная база, которая подтверждает, что прием пробиотиков эффективно предотвращает диарею, вызванную антибиотикотерапией. Эксперты ESPGHAN3 рекомендуют использовать Saccharomyces boulardii для профилактики диареи, вызванной антибиотикотерапией.4

Dierol®:

  • Защищает организм при приеме антибиотика,
  • Saccharomyces boulardii, содержащийся в Dierol®, снижает риск диареи, вызванной антибиотикотерапией, на 81% 5,
  • Не требует хранения в холодильнике.

Dierol® — механизм действия2

  • Содержит штамм Saccharomyces boulardii, который не разрушается под действием желудочного сока и антибиотиков (кроме противогрибковых препаратов) и сохраняет свою активность в желудочно-кишечном тракте.
  • В отличие от большинства других пробиотических препаратов не колонизирует кишечник, что обычно занимает 2-3 дня.
  • Сразу после введения в организм, бактерии Saccharomyces boulardii начинают размножаться и оказывают благотворное действие на желудочно-кишечный тракт.

Когда следует принимать пищевую добавку Дерол®

  • С первых минут приема антибиотика, одновременно с антибиотиком (кроме противогрибковых препаратов).
  • После окончания антибиотикотерапии рекомендуется продолжить прием препарата Dierol®

для восстановления нормальной микрофлоры кишечника (около 10 дней).
Продукт предназначен для детей старше 6 месяцев и взрослых.
Удобная форма выпуска в каплях позволяет точно дозировать и облегчает применение, особенно для маленьких детей.

письмо

  1. Kotowska M. i wsp. Saccharomyces boulardii in the prevention of antibiotic-associated diarrhoea in children:a randomized double-blind placebo-controlled trial. Alimentary Pharmacology & Therapeutics. 2005. 21(5):583-590.
  2. Vandenplas Y. i wsp. Saccharomyces boulardii in childhood. European Journal of Pediatrics. 2009. 168(3):253-265.
  3. ESPGHAN — European Society for Pediatric Gastroenterology Hepatology and Nutrition (Europejskie Towarzystwo Gastroenterologii, Hepatologii i Żywienia Dzieci).
  4. Szajewska H. i wsp. Probiotics for the prevention of antibiotic associated diarrhea in children. Journal of Pediatric Gastroenterology and Nutrition. 2016. 62(3):495-506.

Состав: рафинированное оливковое масло; Saccharomyces boulardii; глюконат цинка; антиоксидант: смесь токоферолов.





Содержание активных ингредиентов в рекомендуемой суточной дозе

Младенцы и дети младше 3 лет – 2×11 капель

Дети старше 3 лет и взрослые — 22 капли

Saccharomyces boulardii

250 мг

250 мг

цинк

3 мг (30% RДА*)

3 mg (30% RДА*)

*RДА — (% рекомендуемого диетического пособия)

Препарат лучше всего принимать во время еды. Внутри бутылки имеются 2 шарика из нержавеющей стали, которые помогают получить однородную консистенцию. Энергично встряхивать бутылку примерно 15 секунд перед использованием, затем отмерить нужное количество капель в чайную ложку. Принимать сразу неразбавленным или добавить в небольшое количество жидкости (воды, сока или молока) комнатной температуры. Запить большим количеством воды. Образование осадка не указывает на испорченность лекарства.

Рекомендуемая суточная доза:

  • Младенцы и дети младше 3 лет — 11 капель (0,4 мл) 2 раза в день
  • Дети старше 3 лет и взрослые — 22 капли (0,8 мл) один раз в день

Не превышайте рекомендуемую суточную дозу.
Пищевые добавки не являются альтернативой (заменой) разнообразному питанию.
Не употреблять при повышенной чувствительности к какому-либо компоненту препарата.

Бифиформ Бэби | Bifiform ru

Форма выпуска:

Выпускается во флаконах, которые содержат 6,9 мл масляного раствора. Флакон укупорен крышкой, содержащей 200 мг порошка с живыми лиофилизированными бактериями Bifidobacterium animalis lactis BB-12 1х108 КОЕ и Streptococcus thermophilus TH-4 1х107 КОЕ. В комплект также входит дозирующая пипетка.

Объем готовой суспензии содержит не менее 10 порций. Особенности конструкции флакона позволяют приготовить суспензию сразу на весь курс применения и точно дозировать пробиотик с помощью мерной пипетки. Просто, удобно и гигиенично!

Условия хранения: в  недоступном для детей месте, при температуре не выше +25 °С.

Срок годности: 18 месяцев в невскрытой упаковке. После вскрытия и смешивания компонентов хранить не более 14 дней при температуре не выше 25 °С .

Пожалуйста, помните, что перед применением необходимо проконсультироваться с врачом-педиатром.

С более подробной информацией вы можете ознакомиться на упаковке и в листке
–вкладыше.

  1. Корниенко Е.А. и др. Применение пробиотиков в педиатрии: анализ лечебного и профилактического действия с позиций доказательной медицины. Лечащий Врач, 09/2015, № 9, стр. 53-61
  2. Bin-Nun A. et al. Oral probiotics prevent necrotizing enterocolitis in very low birth weight neonates // J Pediatr. 2005; v. 147: p. 192–196.
  3. Saavedra J. M. et al. Long-term consumption of infant formulas containing live probiotic bacteria: tolerance and safety // Am. J. Clin. Nutr. 2004, v. 55, p. 128–131
  4. World Gastroenterology Organisation Global Guidelines, Probiotics and Prebiotics, 2011.
  5. Пахомовская Н.Л., Венедиктова М.М. Влияние микробиоты ребенка первого года жизни на его развитие. Медицинский Совет №2, 2018, стр. 232-237.
  6. Agency response letter GRAS Notice No GRN 000049, U.S. Food and Drug Administration Center for Food Safety and Applied Nutrition Office of Food Additive Safety, March 19, 2002
  7. Nopchinda S. et  al., Effect of bifidobacterium BB-12 with or without Streptococcus thermophilus supplemented formula on nutritional statu,s J Med Assoc Thai. 2002 Nov;85 Suppl 4:S1225-31
  8. Беляева И.А. ccоавт., Эффективность использования пробиотиков у недошенных детей,  РМЖ, том 17, №15, 2009, стр. 1000-4;
  9. Мазанкова Л.Н.с  соавт.,Ротавирусная инфекция у детей раннего возраста: обоснование пробиотической терапии,  Детские инфекции, 2011, №2, стр. 52-56;
  10. Турти Т.В. ccоавт., Коррекция микробиоценоза у детей раннего возраста с последствиями перинатальной паталогии,  Педиатрическая фармакология, Выпуск№ 5 / том 6 / 2009;
  11. Нацпрограмма оптимизации вскармливания детей первого года жизни в РФ, 2009.
  12. Информация на упаковке БИФИФОРМ Бэби, информация от завода-производителя

PP-BIF-RUS-0335

инструкция, как принимать, аналоги, побочное действие

1 декабря 2012 | просмотры: 137 099

Содержание статьи:

  1. Инструкция по применению
  2. Что это за препарат
  3. Как выпускается
  4. Бифидумбактерин для малюток
  5. Сравнение препаратов, содержащих бифидобактерии
  6. Применение препарата
  7. Побочные показания
  8. Важность правильной работы ЖКТ

Организм только что появившегося малютки совершенно не приспособлен к самостоятельному существованию, вернее не готов к перевариванию пищи его кишечник. При рождении он полностью стерилен. В нем нет ни хороших, ни плохих микроскопических организмов.

С первыми каплями молока, поступающего в организм, от мамы передаются микроскопические организмы, которые способствуют переработке молока. Для того чтобы маленький кишечник работал без сбоев, ему нужно большое количество работников, которые будут помогать формироваться стенкам, нервным окончаниям и всему ЖКТ. Ведь от того насколько быстро произойдет становление всего процесса зависит насколько малютка будет здоров в дальнейшем.

Обычно с началом употребления молока, малышу хватает маминых ферментов, но после двух недель, наступает нехватка, и кишечник на это реагирует негативно. Начинаются сначала слабые, но потом все усиливающиеся спазматические колики. Почему это происходит? Да потому, что попавшая организм пища сразу вся переработаться не успевает, а под воздействием сока начинает бродить и выделять много газовых пузырьков. В местах наибольшего их скопления происходит спазм, который вызывает крик маленького человека, ведь он не понимает, почему больно. Естественно, родители на это реагируют и начинают искать выход, как помочь своему чаду.

Современная медицина предлагает огромное количество медикаментов, которые могут справиться с задачей по устранению дисбактериоза. Одним из таких является Бифидумбактерин.

Инструкция по применению

РАЗВЕРНУТЬ ИНСТРУКЦИЮ

Форма выпуска, состав и упаковка

Капсулы твердые желатиновые, корпус — белого цвета, крышечка — голубого цвета; содержимое капсул — порошок от светло-серого до темно-серого цвета с черными частицами угля и возможными вкраплениями бежевого цвета, со слабым кисломолочным запахом. 1 капс. (5 доз)
Bifidobacterium bifidum (сорбированные на активированном угле) не менее 50 млн. КОЕ

Вспомогательные вещества: лактоза.

10 — флаконы (1) — пачки картонные.
10 — банки пластиковые (1) — пачки картонные.
18 — флаконы (1) — пачки картонные.
18 — банки пластиковые (1) — пачки картонные.
30 — флаконы (1) — пачки картонные.
30 — банки пластиковые (1) — пачки картонные.

Порошок для приема внутрь от светло-серого до темно-серого цвета с черными частицами угля и возможными вкраплениями бежевого цвета, со слабым кисломолочным запахом. 1 пак. (5 доз)
Bifidobacterium bifidum (сорбированные на активированном угле) не менее 50 млн. КОЕ

Вспомогательные вещества: лактоза.

Пакеты из многослойного металлополимерного материала (10) — пачки картонные.
Пакеты из многослойного металлополимерного материала (30) — пачки картонные.

Клинико-фармакологическая группа:

Препарат, регулирующий равновесие кишечной микрофлоры

Регистрационные №№:
порошок д/приема внутрь 50 млн. КОЕ (5 доз): пак. 10 или 30 — Р N000361/01, 11.08.11. Срок действия рег. уд. не ограничен. ЖНВЛП.
капс. 50 млн.КОЕ (5 доз): фл. 10, 18 или 30 — ЛСР-007830/08, 06.10.08. Срок действия рег. уд. не ограничен. ЖНВЛП.
капс. 50 млн.КОЕ (5 доз): банки 10, 18 или 30 — ЛСР-007830/08, 06.10.08. Срок действия рег. уд. не ограничен. ЖНВЛП.

Фармакологическое действие

Препарат биологического происхождения, регулирующий равновесие кишечной микрофлоры, пробиотик.

Действие препарата обусловлено высокой концентрацией сорбированных на частицах активированного угля бифидобактерий, являющихся антагонистами широкого спектра патогенных (в т.ч. Shigella spp., Salmonella spp., Staphylococcus aureus) и условно патогенных микроорганизмов (в т.ч. Proteus spp., Klebsiella spp.).

Бифидобактерии, сорбированные на специально подготовленном носителе, обеспечивают повышенную клиническую эффективность, быстрое восстановление нормальной микрофлоры. Микрофлора, являясь естественным биосорбентом, аккумулирует в значительном количестве попадающие извне или образующиеся в организме токсические вещества и разлагает их на нетоксические компоненты. Сорбированные бифидобактерии, образуя микроколонии, усиленно активизируют восстановительные и метаболические процессы, пристеночное пищеварение, синтез витаминов и аминокислот, иммунную защиту организма.

Показания к применению препарата БИФИДУМБАКТЕРИН ФОРТЕ®

В качестве монотерапии или в составе комплексной терапии:

  1. дисбактериоз кишечника;
  2. острые кишечные инфекции установленной (шигеллез, сальмонеллез, стафилококковый энтероколит, ротавирусная инфекция) и неустановленной этиологии;
  3. пищевые токсикоинфекции;
  4. ОРВИ;
  5. хронические заболевания с поражением ЖКТ (язвенная болезнь желудка и двенадцатиперстной кишки, панкреатит, холецистит, заболевания печени и желчевыводящих путей), сопровождающиеся дисбактериозом кишечника;
  6. хронические запоры;
  7. синдром мальабсорбции;
  8. аллергические заболевания, сопровождающиеся дисбактериозом кишечника;
  9. пневмония, острые и хронический бронхит, воспалительные заболевания урогенитального тракта, сопровождающиеся дисбактериозом кишечника;
  10. дисбактериоз кишечника, вызванный приемом антибиотиков, антибактериальных препаратов, гормонов, НПВС;
  11. диарея у пациентов, получавших длительное лечение антибиотиками и другими антибактериальными препаратами;
  12. коррекция микробиоценоза кишечника и профилактика гнойно-воспалительных заболеваний у больных хирургического профиля в период предоперационной подготовки и после операций на кишечнике, печени, поджелудочной железе.

С целью профилактики:

  1. внутригоспитальных инфекций в родильных домах и больницах;
  2. дисбактериозов у часто болеющих ОРВИ детей и взрослых.

Режим дозирования

Препарат принимают внутрь во время приема пищи, при необходимости — независимо от приема пищи.

Препарат в форме капсул назначают взрослым и детям в возрасте 3 лет и старше. Капсулы принимают, запивая кипяченой водой или кисломолочным продуктом. Для детей при необходимости капсулы вскрывают, и смешивают ее содержимое с жидкой пищей, предпочтительно с кисломолочным продуктом. Содержимое капсулы можно смешать с 20-50 мл кипяченой воды комнатной температуры, при этом образуется мутная взвесь с частичками сорбента черного цвета. Полученную водную взвесь следует выпить, не добиваясь полного растворения.

Препарат в форме порошка для приема внутрь назначают взрослым и детям всех возрастных групп. Порошок перед употреблением смешивают с жидкой пищей, предпочтительно с кисломолочным продуктом, для новорожденных и грудных детей — с материнским молоком или смесью для искусственного вскармливания. Порошок можно смешать с 30-50 мл кипяченой воды комнатной температуры, при этом образуется мутная взвесь с частичками сорбента черного цвета. Полученную водную взвесь следует выпить, не добиваясь полного растворения.

В зависимости от тяжести заболеваний Бифидумбактерин форте применяют в обычных или увеличенных дозах.

С целью лечения препарат в обычных дозах назначают пациентам всех возрастных групп.

Обычная доза для взрослых составляет по 2 капсулы или по 2 пакетика 2-3; для детей в возрасте 3 лет и старше — по 1 капсуле 3-4, в возрасте 1 года и старше — по 1 пакетику 3-4, в возрасте до 1 года — по 1 пакетику 2-3

Курс лечения при острых кишечных инфекциях и пищевых токсикоинфекциях составляет 5-7 дней, при других заболеваниях — 15-21 день, в зависимости от характера и тяжести заболевания. При необходимости курсы лечения можно повторить 2-3 раза, каждый курс проводится через месяц после окончания предыдущего курса лечения.

При хирургической патологии препарат применяют в течение 3-5 дней до операции и в течение 10-15 дней после операции: взрослым назначают по 2 капсулы или по 2 пакетика 3; детям в возрасте 3 лет и старше — по 1 капсуле 3-4, в возрасте 1 года и старше — по 1 пакетику 3-4, в возрасте до 1 года — по 1 пакетику 3

С целью лечения препарат в увеличенных дозах назначают взрослым и детям в возрасте 1 года и старше.

При острой кишечной инфекции и острой респираторной вирусной инфекции препарат назначают с первых суток заболевания: взрослым — по 10 капсул или по 10 пакетиков 3; детям в возрасте 3 лет и старше — по 3-5 капсул каждые 2 ч до 6 раз/, в возрасте 1 года и старше — по 5 пакетиков 6 раз/ Курс лечения составляет 1-3 дня, в зависимости от тяжести состояния.

При хронических заболеваниях ЖКТ назначают взрослым по 10 капсул или 10 пакетиков 1-3; детям в возрасте 3 лет и старше — по 5 капсул 1-3, в возрасте 1 года и старше — по 5 пакетиков 1-3 Курс лечения составляет 10-14 дней.

При применении у детей капсулы рекомендуется вскрывать и смешивать их содержимое с 50 мл кипяченой воды комнатной температуры.

С целью профилактики Бифидумбактерин форте назначают взрослым и детям старше 3 лет по 1-2 капсулы или по 1-2 пакетика 1-2; детям в возрасте до 1 года — по 1 пакетику 1 раз/ Профилактический курс составляет 10-15 дней 2-3год. Для профилактики внутрибольничных инфекций в родильных домах и больницах препарат применяют 5-10 дней.

Побочное действие

При применении по показаниям в рекомендуемых дозах побочное действие препарата не установлено.

Противопоказания к применению препарата БИФИДУМБАКТЕРИН ФОРТЕ®

индивидуальная непереносимость препарата.

Применение препарата БИФИДУМБАКТЕРИН ФОРТЕ® при беременности и кормлении грудью

Препарат разрешен для применения при беременности и в период лактации (грудного вскармливания).

Применение у детей

Препарат применяют у детей (см. Режим дозирования).

Особые указания

С осторожностью следует применять препарат при лактазной недостаточности.

Передозировка

Передозировка препарата Бифидумбактерин форте невозможна в связи с отсутствием кумулятивного действия.

Лекарственное взаимодействие

При одновременном приеме с витаминами (особенно группы В) действие препарата усиливается.

При приеме с антибиотиками возможно снижение терапевтической эффективности препарата.

Условия отпуска из аптек

Препарат разрешен к применению в качестве средства безрецептурного отпуска.

Условия и сроки хранения

Пакеты следует хранить при температуре не выше 10°С. Нижняя граница температуры не лимитируется. Транспортирование осуществляется при температуре не выше 10°С; допускается транспортирование при температуре до 20°С не более 10 Капсулы следует хранить при температуре от 2° до 10°С. Срок годности — 1 год.

Препарат следует хранить в недоступном для детей месте.

Что это за препарат Бифидумбактерин

Это медикамент, в основе которого находятся бифидобактерии, то есть микроскопические живые организмы, которые попадая в кишечник, стабилизируют его работу. Бифидумбактерин для новорожденных педиатры выписывают крохам при сильных расстройствах ЖКТ, для устранения дисбактериоза, недопущения рахита. Также дается слабеньким малюткам, которые страдают анемией и диатезом. При переходе с грудного кормления на смеси, также дают Бифидумбактерин для детей.

Медикамент является комплексным восстанавливающим лекарством, которое позволяет не только устранить расстройства в ЖКТ, дополнить недостающие микроскопические организмы, но и имеет способность быть антибактериальным к патогенным микроорганизмам. Он является иммуномодулирующим препаратом.

Как выпускается Бифидумбактерин

Есть четыре разных формы, в пузырьках, в ампулах, в таблетках и порошкообразный в отдельных пакетиках. Грудничкам дают все виды кроме таблетованного. Большинство педиатров назначают грудничкам медикамент в порошке, так как он благодаря своей форме легко разводится и содержит сухие бактерии в комплексе с чистой лактозой.

Разработан медикамент так, что он удаляет среду культивирования, при которой более 10% мертвых бактерий выводится из ЖКТ. Растворяясь в жидкости, он приобретает бесцветную и без запаха смешанную массу, которая совершенно без вкуса. Добавление лактозы помогает ускорению разрастания бифидобактерий в организме.

Бифидумбактерин для малюток

Медицина несовершенна и поэтому медикаменты, которые распространены и часто употребляются, не способствуют сохранению хорошей микроскопической флоры в организме. Поэтому прогрессирует дисбактериоз и различные заболевания ЖКТ.

Выбирая Бифидумбактерин для новорожденных, необходимо знать, как его принимать и при каких обстоятельствах. Употребляется он тогда, когда обнаружено неправильное заселение ЖКТ микроскопическими организмами. Это происходит, когда ребенок рождается с маленьким весом, последствием кесарева сечения, ранее назначенного срока и при других причинах, при которых возникают отклонениях в работе ЖКТ.

Питательная работа для малютки является главенствующей, впоследствии наиболее важной, так как работа ЖКТ отражается на всей жизнедеятельности организма, как у малышей, так и взрослых. Работоспособный ЖКТ – залог здоровья малютки. Основные жители кишечной области малютки в первые дни и месяцы существования являются бифидобактерии, то для улучшения работы и приведения в норму кишечника используются бифидомедикаменты.

Бифидумбактерин, применение препарата

Схема использования препарата зависит от состояния ЖКТ, которое наблюдается педиатром на протяжении нескольких месяцев жизни малютки. Давать медикамент нужно на пустой желудок, либо за полчаса до еды, либо через час после.

Бифидумбактерин для новорожденных разводить следует с молоком. Грудничкам, питающимся смесями, разводят в питании для растворения. Малюткам до 6 месячного возраста нужно давать медикамент по 1 пакетику в течение 3 раз на день. Протяженность применения зависит от состояния и самочувствия крохи, а также решения педиатра. Обычно длительность курса 21 день, с повтором через месяц.

При дисбактериозе медикамент дают по 1 пакету в сутки, продолжительность приема 1-1,5 недели. Бифидумбактерин сухой нужно разбавлять прокипяченной воды. Во вкладыше к медикаменту написано, что одну дозировку нужно разбавлять пятью миллилитрами воды, но напоить малютку 25 мл фактически невозможно, поэтому нужно уменьшить воду. Чайную ложку воды заливают в пузырек с порошкообразной смесью, ждут полного растворения и все, медикамент готов.

Сравнение препаратов, содержащих бифидобактерии

Что лучше — Линекс или Бифидумбактерин, ответить непросто. Каждый из этих медикаментов имеет в себе бифидобактерии, разница только в остальных составляющих. Бифидумбактерин форте содержит в себе высушенные микроскопические живые организмы, в одной дозировке которого сдержится 10 в восьмой степени единиц колонизирующих бактерий.

Линекс содержит энтерококки и лактобациллы, а так же лактозу. В состав одной капсулы включено 1,2 * 10 в седьмой степени живых вакуумно высушенных молочнокислых микроскопических бактерий – такое же содержание в обычном кефире. Бифидум жидкий, то есть микроскопические организмы работают быстрее, так как они не были высушены, то после проникновения в организм сразу примутся за работу, их не нужно будить от спячки в отличие от сухих. Бифидумбактерин и Линекс практически одно и то же.

Бифидумбактерин в ампулах, то же самое что и в пузырьках – это вакуумно высушенные микроскопические организмы, которые обработаны желейной подкармливающей массой, можно употреблять всем возрастам малышей. В каждом пузырьке или ампуле содержится пять дозировочных порций. В отличие от порошковой, среда микроскопических организмов не очищается от подкармливающей, поэтому микроскопические организмы попадая в кишечную среду начинают быстро размножаться и захватывать области для своей деятельности.

Побочные показания

Бифидумбактерин не имеет побочных показаний, кроме аллергических у небольшого количества малюток. Это непереносимость, каких-либо из компонентов, имеющихся в ампулах или пузырьках. У грудничков часто отсутствует или есть в небольших количествах лактаза, которая переваривает молочный сахар. У таких крох употребление медикамента может дать вздутие животика и колики, потому что содержит молочный сахар в подкармливающей среде. Поэтому деткам лучше употреблять порошкообразный медикамент.

Нужно не забыть, что входящие в состав лактоза, крахмал высушенный, и стеарат кальция могут вызвать аллергические реакции. Поэтому следует внимательно отнестись к непереносимости этих компонентов.

Бифидумбактерин, основные аналоги медикамента:

  1. Биологическая масса бифидобактерий вакуумно высушенная,
  2. Бифинорм,
  3. Лактобактерин,
  4. Профибор.

Важность правильной работы ЖКТ

Таким образом, чтобы малютка развивался правильно, рос здоровым, нужно научить с самого рождения работать правильно его ЖКТ. Ведь в основном все болезни от перебоев в переваривании продуктов, вследствие чего организм получает авитаминоз. Не работают микроскопические организмы или патогенные превышают норму, получается дисбактериоз.

Недополученные организмом питательные вещества с перерабатывающего завода под названием кишечник, приведут к полному упадку сил, плохому настроению и болезненному состоянию. Поэтому с детства нужно следить за развитием ЖКТ, правильным его наполнением и предохранением от вздутия и колик.

Поступающие в ЖКТ микроскопические организмы образовывают свои колонии и не допускают туда болезнетворные. Они обволакивают место своего существования защитной пленкой, которая помогает работе стенок кишечника. Под воздействием хороших бактерий развиваются нервные окончания, и маленький кишечник приспосабливается к приему новых пищевых дополнений. Ведь малютка получает не только молоко или смесь, к которым привыкает с первых дней от рождения.

Со временем в кишечник будут поступать сок, пюре и каша, которые нужно усиленно переработать. И отсутствие или недостаток микроскопических организмов приведет к моментальному вздутию животика и коликам, то есть сильным болезненным спазмам. Поэтому чтобы не допустить подобного, нужно с первых дней наполнить маленький кишечник хорошими, помогающими микроскопическими организмами.

Бифидобактерии населяют организмы взрослых и малышей, часто бывает, что взрослый человек хватается за бок, его живот надулся, и образованные пузырьки воздуха вызывают болезненные ощущения. Это дисбактериоз. То есть ЖКТ недополучил нужные элементы в детстве, и во взрослой жизни продолжилась нестабильная работа кишечника.

Каждая мама и каждый папа заботится о своем малютке, поэтому с его рождения помогает настроиться на взрослую жизнь. Давая бифидобактерии, можно избавить малыша от страданий в маленьком возрасте и от последствий в большом.

Обзор, применение, побочные эффекты, меры предосторожности, взаимодействия, дозировка и отзывы

Акацу, Х. , Ивабучи, Н., Сяо, Д.З., Мацуяма, З., Курихара, Р., Окуда, К., Ямамото, Т. и Маруяма М. Клинические эффекты пробиотика Bifidobacterium longum BB536 на иммунную функцию и кишечную микробиоту у пожилых пациентов, получающих питание через зонд. JPEN J Parenter Enteral Nutr 11-27-2012; Просмотреть аннотацию.

Андраде, С. и Борхес, Н. Влияние ферментированного молока, содержащего Lactobacillus acidophilus и Bifidobacterium longum, на липиды плазмы женщин с нормальным или умеренно повышенным холестерином.J.Dairy Res. 2009; 76 (4): 469-474. Просмотреть аннотацию.

Арая-Кодзима Томоко, Яэшима Томоко Исибаши Норио Симамура Сейичи Хаясава Хиротоши. Ингибирующее действие Bifidobacterium longum BB536 на вредные кишечные бактерии. Бифидобактерии Microflora 1995; 14 (2): 59-66.

Баллонг Дж., Гриль Дж. Барат-Евлог П. Действие по цвету кишечных ферментов с бифидобактериями. Lait 1993; 73: 249-256.

Беннет Р., Норд К. Э. и Зеттерстром Р. Временная колонизация кишечника новорожденных младенцев перорально вводимыми бифидобактериями и лактобактериями.Acta Paediatr. 1992; 81 (10): 784-787. Просмотреть аннотацию.

Chouraqui, JP, Grathwohl, D., Labaune, JM, Hascoet, JM, de, Montgolfier, I, Leclaire, M., Giarre, M., and Steenhout, P. Оценка безопасности, переносимости и защитного эффекта против диареи смесей для младенцев, содержащих смеси пробиотиков или пробиотиков и пребиотиков, в рандомизированном контролируемом исследовании. Am.J Clin.Nutr. 2008; 87 (5): 1365-1373. Просмотреть аннотацию.

Дас Р.Р. Сингх М., Шафик Н. Пробиотики в лечении аллергического ринита.Журнал Всемирной организации аллергии 2010; 3 (9): 239-244.

del Giudice, M. M. и Brunese, F. P. Пробиотики, пребиотики и аллергия у детей: что нового за последний год? J Clin.Gastroenterol. 2008; 42 Приложение 3, часть 2: S205-S208. Просмотреть аннотацию.

Dimidi E, Zdanaviciene A, Christodoulides S, et al. Рандомизированное клиническое исследование: пробиотик Bifidobacterium lactis NCC2818 по сравнению с плацебо и влияние на время прохождения через кишечник, симптомы и микробиологию кишечника при хроническом запоре. Алимент Pharmacol Ther.2019; 49 (3): 251-264. Просмотреть аннотацию.

Фирмансьях, А., Двапурванторо, П.Г., Кадим, М., Алатас, С., Конус, Н., Лестарина, Л., Буиссе, Ф., и Стинхаут, П. Улучшение роста малышей, которых кормили молоком, содержащим синбиотики . Азия Pac.J Clin.Nutr. 2011; 20 (1): 69-76. Просмотреть аннотацию.

Джанотти, Л., Морелли, Л., Гальбиати, Ф., Роккетти, С., Коппола, С., Бенедуче, А., Джилардини, К., Зоненсчейн, Д., Несполи, А., и Брага, M. Рандомизированное двойное слепое исследование периоперационного введения пробиотиков пациентам с колоректальным раком.Мир Дж. Гастроэнтерол. 1-14-2010; 16 (2): 167-175. Просмотреть аннотацию.

Хаскоет, Дж. М., Хьюберт, К., Рошат, Ф., Леганер, Х., Гага, С., Эмади-Азар, С., и Стинхаут, П. Г. Влияние состава смеси на развитие микробиоты кишечника младенца. J Педиатр, гастроэнтерол, питание. 2011; 52 (6): 756-762. Просмотреть аннотацию.

Игараси М., Иияма И Като Р. Томита М. Асами Н. Эзава И. Влияние Bifidobacterium longum и лактулозы на прочность кости в моделях остеопороза после овариэктомии.Бифид 1994; 7: 139-147.

Ивабучи Н., Хирута Н. Канетада С. Яешима Т. Ивацуки К. Ясуи Х. Влияние интраназального введения Bifidobacterium longum BB536 на иммунную систему слизистой оболочки дыхательных путей и вирусную инфекцию гриппа у мышей. Наука о молоке 2009; 38 (3): 129-133.

Ивабучи, Н., Такахаши, Н., Сяо, Дж. З., Мияджи, К., и Ивацуки, К. In vitro Th2-независимые цитокин-независимые Th3 подавляющие эффекты бифидобактерий. Microbiol.Immunol. 2007; 51 (7): 649-660. Просмотреть аннотацию.

Ивабути, Н., Такахаши, Н., Сяо, Дж. З., Йонедзава, С., Яэшима, Т., Ивацуки, К., и Хачимура, С. Подавляющее действие Bifidobacterium longum на производство Th3-привлекающих хемокинов индуцировало с взаимодействиями Т-лимфоцитов с антиген-презентирующими клетками. FEMS Immunol.Med.Microbiol. 2009; 55 (3): 324-334. Просмотреть аннотацию.

Iwabuchi, N., Xiao, J. Z., Yaeshima, T. , and Iwatsuki, K. Пероральное введение Bifidobacterium longum уменьшает инфекцию вируса гриппа у мышей. Биол.Pharm.Bull. 2011; 34 (8): 1352-1355. Просмотреть аннотацию.

Кагеяма Т., Накано и Томода Т. Сравнительное исследование перорального приема некоторых препаратов бифидобактерий. Медицина и биология (Япония) 1987; 115 (2): 65-68.

Кагеяма Т., Томода Т. Накано Ю. Эффект введения бифидобактерий у пациентов с лейкемией. Бифидобактерии Microflora. 1984; 3 (1): 29-33.

Кондо, Дж., Сяо, Дж. З., Сирахата, А., Баба, М., Абэ, А., Огава, К., и Симода, Т. Модулирующие эффекты Bifidobacterium longum BB536 на дефекацию у пожилых пациентов, получающих энтеральное питание .Всемирный журнал J Gastroenterol 4-14-2013; 19 (14): 2162-2170. Просмотреть аннотацию.

Мацумото, Т., Исикава, Х., Татеда, К., Яэшима, Т., Ишибаши, Н. и Ямагути, К. Пероральное введение Bifidobacterium longum предотвращает вызванный кишечником сепсис Pseudomonas aeruginosa у мышей. J Appl.Microbiol. 2008; 104 (3): 672-680. Просмотреть аннотацию.

Намба К., Яешима Т. Исибаши Н. Хаясава Х и Ямадзаки Сёдзи. Ингибирующее действие Bifidobacterium longum на энтерогеморрагическую Escherichia coli O157: H7. Биологическая микрофлора 2003; 22 (3): 85-91.

Намба К., Хатано М., Яешима Т., Такасе М. и Сузуки К. Влияние введения Bifidobacterium longum BB536 на инфекцию гриппа, титр антител к вакцине против гриппа и клеточный иммунитет у пожилых людей . Biosci.Biotechnol.Biochem. 2010; 74 (5): 939-945. Просмотреть аннотацию.

Одамаки, Т., Сугахара, Х., Ёнэдзава, С., Яешима, Т., Ивацуки, К., Танабэ, С., Томинага, Т., Тогаши, Х., Бенно, Ю., и Сяо, JZ Влияние перорального приема йогурта, содержащего Bifidobacterium longum BB536, на количество клеток энтеротоксигенных Bacteroides fragilis в микробиоте.Анаэроб. 2012; 18 (1): 14-18. Просмотреть аннотацию.

Odamaki, T., Xiao, JZ, Iwabuchi, N., Sakamoto, M., Takahashi, N., Kondo, S., Iwatsuki, K., Kokubo, S., Togashi, H. , Enomoto, T. , и Бенно, Ю. Колебания фекальной микробиоты у людей с поллинозом японского кедра во время сезона пыльцы и влияние приема пробиотиков. J Investig.Allergol.Clin.Immunol. 2007; 17 (2): 92-100. Просмотреть аннотацию.

Одамаки, Т., Сяо, Дж. З., Ивабучи, Н., Сакамото, М., Такахаши, Н., Кондо, С., Мияджи, К., Ивацуки, К., Тогаши, Х., Эномото, Т., и Бенно, Ю. Влияние потребления Bifidobacterium longum BB536 на фекальную микробиоту у людей с поллинозом японского кедра в сезон пыльцы. J Med.Microbiol. 2007; 56 (Pt 10): 1301-1308. Просмотреть аннотацию.

Одамаки, Т., Сяо, Дж. З., Сакамото, М., Кондо, С., Яешима, Т., Ивацуки, К., Тогаши, Х., Эномото, Т., и Бенно, Ю. Распространение различных видов группы Bacteroides fragilis у лиц с поллинозом японского кедра.Appl.Environ.Microbiol. 2008; 74 (21): 6814-6817. Просмотреть аннотацию.

Огата Т., Кингаку М. Яэшима Т. Терагути С. Фукуватари и Ишибаши Н. Хаясава Х. Фудзисава Т. Лино Х. Влияние приема йогурта Bifidobacterium longum BB536 на кишечную среду здоровых взрослых. Microb Ecol Health Dis 1999; 11: 41-46.

Огата Т., Накамура Т. Анджитсу К. Яешима Т. Такахаши С. Фукуватари Й Ишибаши Н. Хаясава Х. Фудзисава Т. Иино Х. Влияние введения Bifidobacterium longum BB536 на кишечную среду, частоту дефекации и фекальные характеристики добровольцев.Biosci Microflora 1997; 16: 53-58.

Орраге, К., Шостедт, С., и Норд, С. E. Влияние добавок с молочнокислыми бактериями и олигофруктозой на микрофлору кишечника при введении цефподоксима проксетила. J Antimicrob.Chemother. 2000; 46 (4): 603-612. Просмотреть аннотацию.

Пуччио, Г., Кахоццо, К., Мели, Ф., Рошат, Ф., Гратволь, Д., и Стинхаут, П. Клиническая оценка новой закваски для младенцев, содержащей живые Bifidobacterium longum BL999 и пребиотики.Питание 2007; 23 (1): 1-8. Просмотреть аннотацию.

Редди Б. С. и Ривенсон А. Ингибирующее действие Bifidobacterium longum на канцерогенез толстой кишки, молочной железы и печени, индуцированное 2-амино-3-метилимидазо [4,5-f] хинолином, пищевым мутагеном. Cancer Res. 9-1-1993; 53 (17): 3914-3918. Просмотреть аннотацию.

Rouge, C., Piloquet, H., Butel, MJ, Berger, B., Rochat, F., Ferraris, L., Des, Robert C., Legrand, A., de la Cochetiere, MF, N ‘ Гайен, Дж. М., Водовар, М., Войер, М., Дармаун, Д., и Розе, Дж.C. Пероральный прием пробиотиков у недоношенных новорожденных с очень низкой массой тела при рождении: рандомизированное двойное слепое плацебо-контролируемое исследование. Am.J Clin.Nutr. 2009; 89 (6): 1828-1835. Просмотреть аннотацию.

Секи М., Игараси Т. Фукуда И Симамура С. Касвашима Т. Огаса К. Влияние кисломолочного продукта Bifidobacterium на «регулярность» среди пожилых людей. Nutr Foodstuff 1978; 31: 379-387.

Sekine I, Yoshiwara S Homma N Takanori H Tonosuka S. Влияние молока, содержащего бифидобактерии, на хемилюминесцентную реакцию периферических лейкоцитов и средний корпускулярный объем эритроцитов — возможная роль Bifidobacterium в активации макрофагов.Therapeutics (Япония) 1985; 14: 691-695.

Simakachorn, N., Bibiloni, R., Yimyaem, P., Tongpenyai, Y., Varavithaya, W., Grathwohl, D., Reuteler, G., Maire, JC, Blum, S., Steenhout, P. , Benyacoub, J., и Schiffrin, EJ. Толерантность, безопасность и влияние на фекальную микробиоту энтеральной смеси, дополненной пре- и пробиотиками, у детей в критическом состоянии. J Педиатр, гастроэнтерол, питание. 2011; 53 (2): 174-181. Просмотреть аннотацию.

Сингх, Дж., Ривенсон, А., Томита, М., Шимамура, С., Ishibashi, N., and Reddy, B. S. Bifidobacterium longum, кишечная бактерия, продуцирующая молочную кислоту, ингибирует рак толстой кишки и модулирует промежуточные биомаркеры канцерогенеза толстой кишки. Канцерогенез 1997; 18 (4): 833-841. Просмотреть аннотацию.

Soh, SE, Aw, M., Gerez, I., Chong, YS, Rauff, M., Ng, YP, Wong, HB, Pai, N., Lee, BW, and Shek, LP Пробиотические добавки в первые 6 месяцев жизни у азиатских младенцев из группы риска — влияние на экзему и атопическую сенсибилизацию в возрасте 1 года.Клиническая экспертиза аллергии 2009; 39 (4): 571-578. Просмотреть аннотацию.

Takeda, Y., Nakase, H., Namba, K., Inoue, S., Ueno, S., Uza, N., and Chiba, T. Улучшается регуляция T-bet и молекул плотных контактов с помощью Bifidobactrium longum воспаление толстой кишки при язвенном колите. Воспаление. 2009; 15 (11): 1617-1618. Просмотреть аннотацию.

Тан, М. Л., Лахтинен, С. Дж., И Бойл, Р. Дж. Пробиотики и пребиотики: клинические эффекты при аллергических заболеваниях. Curr.Opin.Pediatr. 2010; 22 (5): 626-634. Просмотреть аннотацию.

Томода Т., Накано Ю. Кагеяма Т. Разрастание кишечных Candida и кандидозная инфекция у пациентов с лейкемией: эффект от введения бифидобактерий. Бифидобактерии Microflora 1988; 7 (2): 71-74.

Томода Т., Накано Ю. Кагеяма Т. Изменения в небольших группах постоянной кишечной флоры во время приема противоопухолевых или иммунодепрессивных препаратов. Медицина и биология (Япония) 1981; 103 (1): 45-49.

Сяо Дж., Кондол С Одамаки Т Миядзи К Яешима Т Ивацуки К Тогаши Х Бенно Й.Влияние йогурта, содержащего Bifidobacterium longum BB 536, на частоту дефекации и фекальные характеристики здоровых взрослых: двойное слепое перекрестное исследование. Японский журнал молочнокислых бактерий 2007; 18 (1): 31-36.

Xiao, JZ, Kondo, S., Takahashi, N., Odamaki, T., Iwabuchi, N., Miyaji, K., Iwatsuki, K., and Enomoto, T. Изменения уровней TARC в плазме во время пыльцы японского кедра сезон и связь с развитием симптомов. Int.Arch.Allergy Immunol. 2007; 144 (2): 123-127.Просмотреть аннотацию.

Xiao, JZ, Kondo, S., Yanagisawa, N., Miyaji, K., Enomoto, K., Sakoda, T., Iwatsuki, K., and Enomoto, T. Клиническая эффективность пробиотика Bifidobacterium longum для лечения симптомов аллергии на пыльцу японского кедра у субъектов, оцениваемых в отделении воздействия окружающей среды. Аллергол. 2007; 56 (1): 67-75. Просмотреть аннотацию.

Сяо, Дж. З., Кондо, С., Янагисава, Н., Такахаши, Н., Одамаки, Т., Ивабути, Н., Ивацуки, К., Кокубо, С., Тогаши, Х., Эномото, К.и Эномото Т. Эффект пробиотика Bifidobacterium longum BB536 [скорректированный] в облегчении клинических симптомов и модуляции уровней цитокинов в плазме поллиноза японского кедра во время сезона пыльцы. Рандомизированное двойное слепое плацебо-контролируемое исследование. J Investig.Allergol.Clin.Immunol. 2006; 16 (2): 86-93. Просмотреть аннотацию.

Сяо, Д.З., Кондо, С., Янагисава, Н., Такахаши, Н., Одамаки, Т., Ивабути, Н., Миядзи, К., Ивацуки, К., Тогаши, Х., Эномото, К. и Эномото Т. Пробиотики в лечении поллиноза японского кедра: двойное слепое плацебо-контролируемое исследование.Клинический опыт аллергии 2006; 36 (11): 1425-1435. Просмотреть аннотацию.

Яешима Т., Такахаши С. Мацумото Н. Исибаши Н. Хаясава Х. Лино Х. Влияние йогурта, содержащего Bifidobacterium longum BB536, на кишечную среду, фекальные характеристики и частоту дефекации: сравнение со стандартным йогуртом. Biosci Microflora 1997; 16: 73-77.

Яешима Т., Такахаши С Огура А Конно Т. Ивацуки К. Исибаши Н. Хаясава Х. Влияние неферментированного молока, содержащего Bifidobacterium longum BB536, на частоту дефекации и характеристики кала у здоровых взрослых.Журнал Nutrition Food 2001; 4 (2): 1-6.

Яешима Т., Такахаси С Ота С. Накагава К. Ишибаши Н Хирамацу А Охаши Т. Хаясава Х Иино Х. Влияние сладкого йогурта, содержащего Bifidobacterium longum BB536, на частоту дефекации и фекальные характеристики здоровых взрослых людей: сравнение со сладким стандартным йогуртом. Kenko Eiyo Shokuhin Kenkyu 1998; 1 (3/4): 29-34.

Ямазаки, С., Мачии, К., Цуюки, С., Момосе, Х., Кавашима, Т. и Уэда, К. Иммунологические реакции на моноассоциированные Bifidobacterium longum и их связь с предотвращением бактериальной инвазии.Иммунология 1985; 56 (1): 43-50. Просмотреть аннотацию.

Зивковиц, М., Фекаду, К., Зонтаг, Г., Набингер, У., Хубер, У.В., Кунди, М., Чакраборти, А., Фуасси, Х., и Кнасмюллер, С. -индуцированное повреждение ДНК в толстой кишке и печени крыс различными штаммами лактобацилл. Канцерогенез 2003; 24 (12): 1913-1918. Просмотреть аннотацию.

Аль Фалех К., Анабрис Дж. Пробиотики для профилактики некротического энтероколита у недоношенных детей. Кокрановская база данных Syst Rev.2014; (4): CD005496.Просмотреть аннотацию.

АльФалех К., Анабрис Дж., Басслер Д., Аль-Харфи Т. Пробиотики для профилактики некротического энтероколита у недоношенных детей. Кокрановская база данных систематических обзоров 2011 г., выпуск 3. Ст. №: CD005496. DOI: 10.1002 / 14651858.CD005496.pub3. Просмотреть аннотацию.

Аллен С.Дж., Джордан С., Стори М., Торнтон К.А., Гравенор М.Б., Гараиова И., Пламмер С.Ф., Ван Д., Морган Г. Пробиотики в профилактике экземы: рандомизированное контролируемое исследование. Arch Dis Child 2014; 99 (11): 1014-9. Просмотреть аннотацию.

Allen SJ, Wareham K, Wang D, Bradley C, Hutchings H, Harris W., Dhar A, Brown H, Foden A, Gravenor MB, Mack D. Лактобациллы и бифидобактерии в профилактике диареи, связанной с антибиотиками, и диареи Clostridium difficile у пожилых стационарных пациентов (PLACIDE): рандомизированное двойное слепое плацебо-контролируемое многоцентровое исследование. Ланцет. 2013, 12 октября; 382 (9900): 1249-57. Просмотреть аннотацию.

Аруначалам К., Гилл Х.С., Чандра РК. Повышение естественной иммунной функции за счет диетического потребления Bifidobacterium lactis (HN019).Eur J Clin Nutr 2000; 54: 263-7. Просмотреть аннотацию.

Атали-Джапе Г., Минаи Н., Натан Э. и др. Результаты для недоношенных маленьких детей по сравнению с подходящими для беременных после приема Bifidobacterium breve M-16 V. J Matern Fetal Neonatal Med. 2020; 33 (13): 2209-2215. Просмотреть аннотацию.

Бадехноуш Б., Карамали М., Заррати М. и др. Влияние пробиотических добавок на биомаркеры воспаления, окислительного стресса и исходы беременности при гестационном диабете. J Matern Fetal Neonatal Med.2018 Май; 31 (9): 1128-1136. Просмотреть аннотацию.

Бастюрк А., Артан Р., Йилмаз А. Эффективность лечения синбиотиками, пробиотиками и пребиотиками при синдроме раздраженного кишечника у детей: рандомизированное контролируемое исследование. Turk J Gastroenterol 2016; 27 (5): 439-43. Просмотреть аннотацию.

Begtrup LM, de Muckadell OB, Kjeldsen J, Christensen RD, Jarbøl DE. Длительное лечение пробиотиками у пациентов первичного звена с синдромом раздраженного кишечника — рандомизированное двойное слепое плацебо-контролируемое исследование.Сканд Дж. Гастроэнтерол 2013; 48 (10): 1127-35. Просмотреть аннотацию.

Бибилони Р., Федорак Р.Н., Таннок Г.В. и др. Пробиотическая смесь VSL # 3 вызывает ремиссию у пациентов с активным язвенным колитом. Am J Gastroenterol 2005; 100: 1539-46. Просмотреть аннотацию.

Blaabjerg S, Artzi DM, Aabenhus R. Пробиотики для профилактики антибиотико-ассоциированной диареи у амбулаторных пациентов — систематический обзор и метаанализ. Антибиотики (Базель). 2017; 6 (4). Просмотреть аннотацию.

Bouhnik Y, Pochart P, Marteau P, et al.Восстановление фекалий у людей жизнеспособных бифидобактерий, попавших в ферментированное молоко. Гастроэнтерология 1992; 102: 875-8. Просмотреть аннотацию.

Батлер С.К., Лау М., Гиллеспи Д. и др. Влияние использования пробиотиков на введение антибиотиков среди жителей домов престарелых: рандомизированное клиническое исследование. ДЖАМА. 2020; 324 (1): 47-56. Просмотреть аннотацию.

Caglar E. Влияние йогурта, содержащего Bifidobacterium bifidum, на бактерии зубного налета у детей. J Clin Pediatr Dent. 2014; 38 (4): 329-32. Просмотреть аннотацию.

Callaway LK, McIntyre HD, Barrett HL и др. Пробиотики для профилактики гестационного сахарного диабета у женщин с избыточным весом и ожирением: результаты двойного слепого рандомизированного контролируемого исследования SPRING. Уход за диабетом. 2019; 42 (3): 364-371. Просмотреть аннотацию.

Chang HY, Chen JH, Chang JH, Lin HC, Lin CY, Peng CC. Пробиотики с множественными штаммами, по-видимому, являются наиболее эффективными пробиотиками в профилактике некротического энтероколита и смертности: обновленный метаанализ. PLoS One.2017; 12 (2): e0171579. Просмотреть аннотацию.

Чен Р.М., Ву Дж.Дж., Ли С.К. и др. Увеличение кишечных бифидобактерий и подавление бактерий группы кишечной палочки при кратковременном приеме йогурта. J Dairy Sci 1999: 82: 2308-14. Просмотреть аннотацию.

Chiang BL, Sheih YH, Wang LH, et al. Повышение иммунитета путем употребления с пищей пробиотических молочнокислых бактерий (Bifidobacterium lactis HN019): оптимизация и определение клеточных иммунных ответов. Eur J Clin Nutr 2000; 54: 849-55. Просмотреть аннотацию.

Colombel JF, Cortot A, Neut C, Romond C. Йогурт с Bifidobacterium longum снижает желудочно-кишечные эффекты, вызванные эритромицином. Ланцет 1987; 2: 43.

Костелое К., Харди П., Ющак Е., Уилкс М., Миллар М.Р .; Пробиотики в совместной группе по изучению недоношенных детей. Bifidobacterium breve BBG-001 у очень недоношенных детей: рандомизированное контролируемое исследование фазы 3. Ланцет. 2016 13 февраля; 387 (10019): 649-60. Просмотреть аннотацию.

Кремонини Ф, Ди Каро С., Ковино М. и др. Влияние различных пробиотических препаратов на побочные эффекты, связанные с терапией против Helicobacter pylori: параллельное групповое, тройное слепое, плацебо-контролируемое исследование.Am J Gastroenterol 2002; 97: 2744-9. Просмотреть аннотацию.

Czajeczny D, Kabzi & nacute; ska K, W & oacute; jciak RW. Помогают ли добавки с пробиотиками похудеть? Рандомизированное простое слепое плацебо-контролируемое исследование с добавлением Bifidobacterium lactis BS01 и Lactobacillus acidophilus LA02. Ешьте расстройство веса. 2020. Посмотреть аннотацию.

Дикерсон Ф., Адамос М., Кацафанас Э. и др. Дополнительные пробиотические микроорганизмы для предотвращения повторной госпитализации пациентов с острой манией: рандомизированное контролируемое исследование.Биполярное расстройство. 2018 25 апреля. Посмотреть аннотацию.

Dimidi E, Christodoulides S, Fragkos KC, Scott SM, Whelan K. Влияние пробиотиков на функциональный запор у взрослых: систематический обзор и метаанализ рандомизированных контролируемых исследований. Am J Clin Nutr. 2014; 100 (4): 1075-84. Просмотреть аннотацию.

Элмер GW, Суравич CM, МакФарланд LV. Биотерапевтические агенты, метод лечения и профилактики отдельных кишечных и вагинальных инфекций, которым пренебрегают. JAMA 1996; 275: 870-5.Просмотреть аннотацию.

Eskesen D, Jespersen L, Michelsen B, Whorwell PJ, Müller-Lissner S, Morberg CM. Действие пробиотического штамма Bifidobacterium animalis subsp. lactis, BB-12®, о частоте дефекации у здоровых субъектов с низкой частотой дефекации и дискомфортом в животе: рандомизированное двойное слепое плацебо-контролируемое исследование в параллельных группах. Br J Nutr. 2015 28 ноября; 114 (10): 1638-46. Просмотреть аннотацию.

Fernández-Carrocera LA, Solis-Herrera A, Cabanillas-Ayón M, Gallardo-Sarmiento RB, García-Pérez CS, Montaño-Rodríguez R, Echániz-Aviles MO.Двойной слепой рандомизированный клинический анализ для оценки эффективности пробиотиков у недоношенных новорожденных с массой тела менее 1500 г в профилактике некротизирующего энтероколита. Arch Dis Child Fetal Neonatal Ed 2013; 98 (1): F5-9. Просмотреть аннотацию.

Gionchetti P, Rizzello F, Venturi A, et al. Пероральная бактериотерапия в качестве поддерживающей терапии у пациентов с хроническим поучитом: двойное слепое плацебо-контролируемое исследование. Гастроэнтерология 2000; 119: 305-9. Просмотреть аннотацию.

Goldenberg JZ, Lytvyn L, Steurich J, Parkin P, Mahant S, Johnston BC.Пробиотики для профилактики детской диареи, связанной с приемом антибиотиков. Кокрановская база данных Syst Rev.2015; (12): CD004827. Просмотреть аннотацию.

Голдин BR. Польза пробиотиков для здоровья. Br J Nutr 1998; 80: S203-7. Просмотреть аннотацию.

Гор C, Custovic A, Tannock GW, Munro K, Kerry G, Johnson K, Peterson C, Morris J, Chaloner C, Murray CS, Woodcock A. Лечебные и вторичные профилактические эффекты пробиотиков Lactobacillus paracasei или Bifidobacterium lactis на раннем этапе детская экзема: рандомизированное контролируемое исследование с последующим наблюдением до возраста 3 лет.Clin Exp Allergy 2012; 42 (1): 112-22. Просмотреть аннотацию.

Guardamagna O, Amaretti A, Puddu PE, et al. Добавка бифидобактерий: влияние на липидный профиль плазмы у детей с дислипидемией. Питание. 2014; 30 (7-8): 831-6. Просмотреть аннотацию.

Ha GY, Yang CH, Kim H, Chong Y. Случай сепсиса, вызванного Bifidobacterium longum. J Clin Microbiol 1999; 37: 1227-8. Просмотреть аннотацию.

Хан К., Ван Дж., Сео Дж. Г., Ким Х. Эффективность пробиотиков с двойным покрытием при синдроме раздраженного кишечника: рандомизированное двойное слепое контролируемое исследование.J Gastroenterol. 2017; 52 (4): 432-443. Просмотреть аннотацию.

Хираяма К., Рафтер Дж. Роль пробиотических бактерий в профилактике рака. Microbes Infect 2000; 2: 681-6. Просмотреть аннотацию.

Hojsak I, Tokic Pivac V, Mocic Pavic A, Pasini AM, Kolacek S. Bifidobacterium animalis subsp. lactis не может предотвратить распространенные инфекции у госпитализированных детей: рандомизированное двойное слепое плацебо-контролируемое исследование. Am J Clin Nutr. 2015 Март; 101 (3): 680-4. Просмотреть аннотацию.

Hoyos AB. Снижение частоты возникновения некротического энтероколита, связанного с энтеральным введением Lactobacillus acidophilus и Bifidobacterium infantis новорожденным в отделении интенсивной терапии.Int J Infect Dis 1999; 3: 197-202. Просмотреть аннотацию.

Ibarra A, Latreille-Barbier M, Donazzolo Y, Pelletier X, Ouwehand AC. Эффекты 28-дневного Bifidobacterium animalis subsp. lactis HN019 в отношении времени прохождения через толстую кишку и желудочно-кишечных симптомов у взрослых с функциональным запором: двойное слепое рандомизированное плацебо-контролируемое исследование с определением дозировки. Кишечные микробы. 2018; 9 (3): 236-251. Просмотреть аннотацию.

Иноуэ Т., Кобаяши Ю., Мори Н. и др. Влияние комбинированного приема бифидобактерий и тренировок с отягощениями на когнитивные функции, состав тела и привычки кишечника здоровых пожилых людей.Benef Microbes. 2018; 9 (6): 843-853. Просмотреть аннотацию.

Исикава Х., Акедо И., Умесаки Ю. и др. Рандомизированное контролируемое исследование влияния ферментированного бифидобактериями молока на язвенный колит. J Am Coll Nutr 2003; 22: 56-63. Просмотреть аннотацию.

Isolauri E, Arvola T, Sutas Y, et al. Пробиотики в лечении атопической экземы. Clin Exp Allergy 2000; 30: 1604-10. Просмотреть аннотацию.

Jäger R, Purpura M, Stone JD и др. Прием пробиотиков Streptococcus thermophilus FP4 и Bifidobacterium breve BR03 снижает работоспособность и объем движений после упражнений, повреждающих мышцы.Питательные вещества 2016; 8 (10). pii: E642. Просмотреть аннотацию.

Jayasimhan S, Yap NY, Roest Y, Rajandram R, Chin KF. Эффективность препарата микробных клеток в улучшении хронического запора: рандомизированное двойное слепое плацебо-контролируемое исследование. Clin Nutr 2013; 32 (6): 928-34. Просмотреть аннотацию.

Jiang C, Wang H, Xia C, et al. Рандомизированное двойное слепое плацебо-контролируемое исследование пробиотиков для уменьшения тяжести мукозита полости рта, вызванного химиолучевой терапией, у пациентов с карциномой носоглотки.Рак. 2019; 125 (7): 1081-1090. Просмотреть аннотацию.

Jiao X, Fu MD, Wang YY, Xue J, Zhang Y. Bifidobacterium и Lactobacillus для предотвращения некротического энтероколита у недоношенных детей с очень низкой массой тела при рождении: систематический обзор и метаанализ. Мир J Pediatr. 2020; 16 (2): 135-142. Просмотреть аннотацию.

Калима П., Мастертон Р.Г., Родди П.Х. и др. Инфекция Lactobacillus rhamnosus у ребенка после трансплантации костного мозга. J Infect 1996; 32: 165-7. Просмотреть аннотацию.

Карамали М., Дадхах Ф., Садрханлоу М. и др.Влияние пробиотических добавок на гликемический контроль и липидный профиль при гестационном диабете: рандомизированное двойное слепое плацебо-контролируемое исследование. Диабет Метаб 2016; 42 (4): 234-41. Просмотреть аннотацию.

Като К., Мизуно С., Умесаки Ю. и др. Рандомизированное плацебо-контролируемое исследование по оценке влияния ферментированного бифидобактериями молока на активный язвенный колит. Алимент Фармакол Тер 2004; 20: 1133-41. Просмотреть аннотацию.

Kim HJ, Camilleri M, McKinzie S, et al. Рандомизированное контролируемое испытание пробиотика VSL # 3 в отношении кишечного транзита и симптомов синдрома раздраженного кишечника с преобладанием диареи.Aliment Pharmacol Ther 2003; 17: 895-904. . Просмотреть аннотацию.

Кобаяси Y, Кухара Т, Оки М, Сяо Джозеф. Влияние Bifidobacterium breve A1 на когнитивные функции пожилых людей с жалобами на память: рандомизированное двойное слепое плацебо-контролируемое исследование. Benef Microbes. 2019; 10 (5): 511-520. Просмотреть аннотацию.

Корщунов В.М., Смеянов В.В., Ефимов Б.А. и др. Терапевтическое применение препарата устойчивых к антибиотикам бифидобактерий у мужчин, подвергшихся воздействию высоких доз гамма-излучения. J Med Microbiol 1996; 44: 70-4.Просмотреть аннотацию.

Кухбахер Т., Отт С.Дж., Хельвиг У. и др. Бактериальная и грибковая микробиота в связи с пробиотической терапией (VSL # 3) при поучите. Кишечник 2006; 55: 833-41. Просмотреть аннотацию.

Langkamp-Henken B, Rowe CC, Ford AL, Christman MC, Nieves C. Jr, Khouri L, Specht GJ, Girard SA, Spaiser SJ, Dahl WJ. Bifidobacterium bifidum R0071 приводит к большему количеству дней здорового образа жизни и меньшему проценту студентов, испытывающих академический стресс, сообщающих о дне простуды / гриппа: рандомизированное двойное слепое плацебо-контролируемое исследование.Br J Nutr. 2015 14; 113 (3): 426-34. Просмотреть аннотацию.

Lau AS, Yanagisawa N, Hor YY, et al. Bifidobacterium longum BB536 облегчает заболевания верхних дыхательных путей и регулирует профили кишечной микробиоты у малазийских дошкольников. Benef Microbes. 2018; 9 (1): 61-70. Просмотреть аннотацию.

Лау С.С., Чемберлен Р.С. Пробиотики эффективны для предотвращения диареи, связанной с Clostridium difficile: систематический обзор и метаанализ. Int J Gen Med. 2016; 9: 27-37. Просмотреть аннотацию.

Льюис Э.Д., Энтони Дж. М., Кроули, округ Колумбия, и др.Эффективность Lactobacillus paracasei HA-196 и Bifidobacterium longum R0175 в облегчении симптомов синдрома раздраженного кишечника (СРК): рандомизированное плацебо-контролируемое исследование. Питательные вещества. 2020; 12 (4): 1159. Просмотреть аннотацию.

Льюис С.Дж., Фридман АР. Обзорная статья: использование биотерапевтических средств в профилактике и лечении желудочно-кишечных заболеваний. Aliment Pharmacol Ther 1998; 12: 807-22. Просмотреть аннотацию.

Leyer GJ, Li S, Mubasher ME, et al. Воздействие пробиотиков на частоту и продолжительность симптомов простуды и гриппа у детей.Педиатрия 2009; 124: e172-e179. Просмотреть аннотацию.

Ливин В., Пайффер И., Худо С. и др. Штаммы Bifidobacterium из резидентной микрофлоры желудочно-кишечного тракта человека грудного возраста обладают антимикробной активностью. Gut 2000; 47: 646-52. Просмотреть аннотацию.

Lin CL, Hsu YJ, Ho HH и др. Bifidobacterium longum subsp. Добавка longum OLP-01 во время тренировок по бегу на выносливость улучшает результаты упражнений у бегунов на средние и длинные дистанции: двойное слепое контролируемое испытание. Питательные вещества. 2020; 12 (7): 1972.Просмотреть аннотацию.

Linn YH, Thu KK, Win NHH. Эффект пробиотиков для профилактики острой радиационно-индуцированной диареи среди пациентов с раком шейки матки: рандомизированное двойное слепое плацебо-контролируемое исследование. Пробиотики, антимикробные белки. 2019; 11 (2): 638-647. Просмотреть аннотацию.

Лю Дж, Хуанг XE. Эффективность таблеток жизнеспособных бактерий Bifidobacterium tetragenous для онкологических больных с функциональным запором. Азиатский Pac J Cancer Prev. 2014; 15 (23): 10241-4. Просмотреть аннотацию.

Macfarlane GT, Каммингс Дж. Х.Пробиотики и пребиотики: может ли регулирование активности кишечных бактерий принести пользу здоровью? BMJ 1999; 318: 999-1003. Просмотреть аннотацию.

Манжалий Э., Вирченко О., Фалалеева Т., Берегова Т., Стреммель В. Лечебная эффективность пробиотического препарата при неалкогольном стеатогепатите: пилотное исследование. J Dig Dis. 2017; 18 (12): 698-703. Просмотреть аннотацию.

Мацуока К., Уэмура Ю., Канаи Т. и др. Эффективность ферментированного молока Bifidobacterium breve в поддержании ремиссии язвенного колита.Dig Dis Sci. 2018; 63 (7): 1910-1919. Просмотреть аннотацию.

McFarland LV. Мета-анализ пробиотиков для профилактики диареи, связанной с антибиотиками, и лечения болезни Clostridium difficile. Am J Gastroenterol 2006; 101: 812-22. Просмотреть аннотацию.

Мейдани С.Н., Ха В.К. Иммунологические эффекты йогурта. Am J Clin Nutr 2000; 71: 861-72. Просмотреть аннотацию.

Майкл Д.Р., Джек А.А., Мазетти Дж. И др. Рандомизированное контролируемое исследование показывает, что добавление лактобактерий и бифидобактерий взрослым с избыточным весом и ожирением снижает массу тела и улучшает самочувствие.Научный доклад 2020; 10 (1): 4183. Просмотреть аннотацию.

Miele E, Pascarella F, Giannetti E. et al. Влияние пробиотического препарата (VSL # 3) на индукцию и поддержание ремиссии у детей с язвенным колитом. Am J Gastroenterol 2009; 104: 437-43. Просмотреть аннотацию.

Мимура Т., Риццелло Ф., Хельвиг У. и др. Терапия пробиотиками в высоких дозах (VSL # 3) один раз в день для поддержания ремиссии при рецидивирующем или рефрактерном поухите. Кишечник 2004; 53: 108-14. Просмотреть аннотацию.

О’Каллаган А, ван Синдерен Д.Бифидобактерии и их роль как членов кишечной микробиоты человека. Front Microbiol. 2016 15 июня; 7: 925. Просмотреть аннотацию.

О’Махони Л., Маккарти Дж., Келли П. и др. Lactobacillus и bifidobacterium при синдроме раздраженного кишечника: реакции симптомов и взаимосвязь с профилями цитокинов. Гастроэнтерология 2005; 128: 541-51. Просмотреть аннотацию.

Olivares M, Castillejo G, Varea V, Sanz Y. Двойное слепое рандомизированное плацебо-контролируемое исследование для оценки эффектов Bifidobacterium longum CECT 7347 у детей с впервые диагностированной целиакией.Br J Nutr. 2014 июл 14; 112 (1): 30-40. Просмотреть аннотацию.

Park MS, Kwon B, Ku S, Ji GE4. Эффективность лечения пробиотиками Bifidobacterium longum BORI и Lactobacillus acidophilus AD031 у младенцев с ротавирусной инфекцией. Питательные вещества. 2017; 9 (8). pii: E887. Просмотреть аннотацию.

Phuapradit P, Varavithya W., Vathanophas K, et al. Снижение ротавирусной инфекции у детей, получающих смесь с бифидобактериями. J Med Assoc Thai 1999; 82: S43-8. Просмотреть аннотацию.

Пирс А.Практическое руководство по натуральным лекарствам Американской фармацевтической ассоциации. Нью-Йорк: The Stonesong Press, 1999: 19.

Pinto GS, Cenci MS, Azevedo MS, Epifanio M, Jones MH. Действие йогурта, содержащего Bifidobacterium animalis subsp. lactis DN-173010 пробиотик на зубном налете и слюне у ортодонтических пациентов. Caries Res. 2014; 48 (1): 63-8. Просмотреть аннотацию.

Pinto-Sanchez MI, Hall GB, Ghajar K, et al. Пробиотик Bifidobacterium longum NCC3001 снижает показатели депрессии и изменяет активность мозга: пилотное исследование у пациентов с синдромом раздраженного кишечника.Гастроэнтерология 2017; 153 (2): 448-459.e8. Просмотреть аннотацию.

Pruccoli G, Silvestro E, Pace Napoleone C, Aidala E, Garazzino S, Scolfaro C. Безопасны ли пробиотики? Бифидобактериальная бактериемия у ребенка с тяжелой сердечной недостаточностью. Infez Med. 2019; 27 (2): 175-178. Просмотреть аннотацию.

Расталл РА. Бактерии в кишечнике: друзья и враги и как изменить баланс. J Nutr 2004; 134: 2022S-2026S. Просмотреть аннотацию.

Rautava S, Kainonen E, Salminen S, Isolauri E. Материнский пробиотик
добавление во время беременности и кормления грудью снижает риск экземы у младенца.J Allergy Clin Immunol. 2012; 130 (6): 1355-60.
Просмотреть аннотацию.

Раутио М., Джусими-Сомер Х, Каума Х и др. Абсцесс печени, вызванный штаммом Lactobacillus rhamnosus, неотличимым от штамма L. rhamnosus GG. Clin Infect Dis 1999; 28: 1159-60. Просмотреть аннотацию.

Rerksuppaphol S, Rerksuppaphol L. Рандомизированное контролируемое исследование пробиотиков для лечения простуды у школьников. Pediatr Int. 2012; 54 (5): 682-7. Просмотреть аннотацию.

Роберфроид МБ. Пребиотики и пробиотики: функциональная пища? Am J Clin Nutr 2000; 71: 1682S-7S.Просмотреть аннотацию.

Роберфроид МБ. Пребиотики и пробиотики: функциональная пища? Am J Clin Nutr. 2000; 71 (6 доп.): 1682С-7С; обсуждение 1688С-90С. Просмотреть аннотацию.

Saavedra JM, et al. Кормление младенцев в больнице бифидобактериями бифидум и термофильным стрептококком для профилактики диареи и выделения ротавируса. Ланцет 1994; 344: 1046-9. Просмотреть аннотацию.

Sadeghi-Bojd S, Naghshizadian R, Mazaheri M, Ghane Sharbaf F, Assadi F. Эффективность пробиотической профилактики после первой лихорадочной инфекции мочевыводящих путей у детей с нормальными мочевыводящими путями.J Pediatric Infect Dis Soc. 2020; 9 (3): 305-310. Просмотреть аннотацию.

Сато С., Учида Т., Кувана С. и др. Бактериемия, вызванная Bifidobacterium breve у новорожденного с экстрофией клоаки. Pediatr Int. 2016; 58 (11): 1226-8. Просмотреть аннотацию.

Saxelin M, Chuang NH, Chassy B и др. Лактобациллы и бактериемия на юге Финляндии 1989-1992 гг. Clin Infect Dis 1996; 22: 564-6. Просмотреть аннотацию.

Scarpignato C, Rampal P. Профилактика и лечение диареи путешественников: клинический фармакологический подход.Химиотерапия 1995; 41: 48-81. Просмотреть аннотацию.

Шмидт Р.М., Пилманн Лаурсен Р., Бруун С. и др. Пробиотики в позднем младенчестве снижают частоту возникновения экземы: рандомизированное контролируемое исследование. Pediatr Allergy Immunol. 2019; 30 (3): 335-340. Просмотреть аннотацию.

Шариф А, Кашани Х. Х., Насри Э, Сулеймани З., Шариф MR. Роль пробиотиков в лечении дизентерии: рандомизированное двойное слепое клиническое испытание. Пробиотики, антимикробные белки. 2017; 9 (4): 380-385. Просмотреть аннотацию.

Shavakhi A, Tabesh E, Yaghoutkar A, Hashemi H, Tabesh F, Khodadoostan M, Minakari M, Shavakhi S, Gholamrezaei A.Влияние пробиотического соединения с множеством штаммов на висмут-содержащую четырехкратную терапию инфекции Helicobacter pylori: рандомизированное плацебо-контролируемое тройное слепое исследование. Helicobacter. 2013; 18 (4): 280-4. Просмотреть аннотацию.

Шен Дж., Цзо З.С., Мао А.П. Влияние пробиотиков на вызывание ремиссии и поддерживающую терапию при язвенном колите, болезни Крона и поучите: метаанализ рандомизированных контролируемых исследований. Воспаление кишечника. 2014; 20 (1): 21-35. Просмотреть аннотацию.

Симрен М., Оман Л., Олссон Дж. И др.Клиническое испытание: влияние ферментированного молока, содержащего три пробиотических бактерии, на пациентов с синдромом раздраженного кишечника — рандомизированное двойное слепое контролируемое исследование. Алимент Фармакол Тер 2010; 31 (2): 218-27. Просмотреть аннотацию.

Сликерман Р.Ф., Кан Дж., Ван Зил Н. и др. Влияние раннего приема пробиотиков на познавательные способности, поведение и настроение в детстве — рандомизированное плацебо-контролируемое исследование. Acta Paediatr. 2018; 107 (12): 2172-2178. Просмотреть аннотацию.

Сёндергаард Б., Олссон Дж., Ольсон К., Свенссон Ю., Байтцер П., Экесбо Р.Влияние пробиотической ферментированного молока на симптомы и кишечную флору у пациентов с синдромом раздраженного кишечника: рандомизированное плацебо-контролируемое исследование. Сканд Дж. Гастроэнтерол 2011; 46 (6): 663-72. Просмотреть аннотацию.

Staudacher HM, Lomer MCE, Farquharson FM, et al. Диета с низким содержанием FODMAP уменьшает симптомы у пациентов с синдромом раздраженного кишечника, а пробиотик восстанавливает виды Bifidobacterium: рандомизированное контролируемое исследование. Гастроэнтерология. 2017; 153 (4): 936-947. Просмотреть аннотацию.

Стенман Л.К., Лехтинен М.Дж., Меланд Н. и др.Пробиотик с клетчаткой или без нее, связанный с сывороточным зонулином, контролирует жировую массу в рандомизированном контролируемом исследовании для взрослых с избыточным весом и ожирением. EBioMedicine 2016; 13: 190-200. Просмотреть аннотацию.

Салливан А, Баркхольт Л, Север СЕ. Lactobacillus acidophilus, Bifidobacterium lactis и Lactobacillus F19 предотвращают связанные с антибиотиками экологические нарушения Bacteroides fragilis в кишечнике. Журнал Antimicrob Chemother 2003; 52: 308-11. Просмотреть аннотацию.

Табберс М.М., Миллиано I, Роузбум М.Г., Беннинга М.А.Эффективны ли Bifidobacterium breve при лечении запоров у детей? Результаты пилотного исследования. Нутр Ж 2011; 10:19. Просмотреть аннотацию.

Tomasz B, Zoran S, Jaroslaw W, Ryszard M, Marcin G, Robert B, Piotr K, Lukasz K, Jacek P, Piotr G, Przemyslaw P, Michal D. Долгосрочное использование пробиотиков Lactobacillus и Bifidobacterium имеет профилактическое действие влияние на возникновение и тяжесть поучита: рандомизированное проспективное исследование. Biomed Res Int. 2014; 2014: 208064. Просмотреть аннотацию.

Tursi A, Brandimarte G, Giorgetti GM, et al.Низкие дозы бальсалазида в сочетании с сильнодействующим пробиотическим препаратом более эффективны, чем один бальсалазид или месалазин при лечении острого язвенного колита легкой или средней степени тяжести. Med Sci Monit 2004; 10: PI126-31. Просмотреть аннотацию.

Вентури А., Джиончетти П., Риццелло Ф. и др. Влияние нового пробиотического препарата на состав фекальной флоры: предварительные данные по поддерживающей терапии больных язвенным колитом. Aliment Pharmacol Ther 1999; 13: 1103-8. Просмотреть аннотацию.

Videlock EJ, Cremonini F.Мета-анализ: пробиотики при диарее, связанной с антибиотиками. Алимент Pharmacol Ther. 2012; 35 (12): 1355-69. Просмотреть аннотацию.

Ван Г, Фэн Д. Терапевтический эффект Saccharomyces boulardii в сочетании с Bifidobacterium и на клеточную иммунную функцию у детей с острой диареей. Exp Ther Med. 2019; 18 (4): 2653-2659. Просмотреть аннотацию.

Wang YH, Huang Y. Влияние добавок Lactobacillus acidophilus и Bifidobacterium bifidum к стандартной тройной терапии на эрадикацию Helicobacter pylori и динамические изменения кишечной флоры.Мир J Microbiol Biotechnol. 2014; 30 (3): 847-53. Просмотреть аннотацию.

Ван Чж, Гао Цюй, Фан Цзюй. Метаанализ эффективности и безопасности препаратов пробиотических соединений, содержащих лактобактерии и бифидобактерии, в эрадикационной терапии Helicobacter pylori. J Clin Gastroenterol. 2013; 47 (1): 25-32. Просмотреть аннотацию.

Whorwell PJ, Altringer L, Morel J, et al. Эффективность инкапсулированного пробиотика Bifidobacterium infantis 35624 у женщин с синдромом раздраженного кишечника.Am J Gastroenterol. Июль 2006; 101 (7): 1581-90. Просмотреть аннотацию.

Wildt S, Nordgaard I, Hansen U, Brockmann E, Rumessen JJ. Рандомизированное двойное слепое плацебо-контролируемое исследование с Lactobacillus acidophilus La-5 и Bifidobacterium animalis subsp. lactis BB-12 для поддержания ремиссии при язвенном колите. J. Crohns Colitis 2011; 5 (2): 115-21. Просмотреть аннотацию.

Wu G, Chen X, Cui N, et al. Профилактическое действие добавок Bifidobacterium на неонатальный холестаз у недоношенных новорожденных с очень низкой массой тела при рождении.Гастроэнтерол Рес Прак. 2020; 2020: 4625315. Просмотреть аннотацию.

Сяо Дж., Кацумата Н., Бернье Ф. и др. Пробиотик bifidobacterium breve в улучшении когнитивных функций пожилых людей с подозрением на легкие когнитивные нарушения: рандомизированное двойное слепое плацебо-контролируемое исследование. J. Alzheimers Dis. 2020; 77 (1): 139-147. Просмотреть аннотацию.

Сяо Дж. З., Такахаши С., Одамаки Т. и др. Чувствительность к антибиотикам штаммов бифидобактерий, распространенных на японском рынке. Biosci Biotechnol Biochem.2010; 74 (2): 336-42. Просмотреть аннотацию.

Замани Б., Голкар Х.Р., Фаршбаф С. и др. Клинический и метаболический ответ на добавление пробиотиков у пациентов с ревматоидным артритом: рандомизированное двойное слепое плацебо-контролируемое исследование. Int J Rheum Dis 2016; 19 (9): 869-79. Просмотреть аннотацию.

Чжан Дж., Ма С., Ву С., Гуо С., Лонг С., Тан Х. Эффекты пробиотических добавок у беременных с гестационным сахарным диабетом: систематический обзор и метаанализ рандомизированных контролируемых исследований.J Diabetes Res. 2019; 2019: 5364730. Просмотреть аннотацию.

Чжу XL, Тан XG, Цюй Ф, Чжэн Y, Чжан WH, Diao YQ. Bifidobacterium может помочь в профилактике некротического энтероколита у недоношенных детей: систематический обзор и метаанализ. Int J Surg. 2019; 61: 17-25. Просмотреть аннотацию.

Границы | Трехмесячное кормление со штаммами Bifidobacterium предотвращает желудочно-кишечные симптомы у здоровых новорожденных

Введение

Детская колика — распространенное заболевание в первые 3 месяца детства, которое поражает до 30% новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Детские колики представляют собой серьезную проблему для семьи, поскольку лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и проблемам; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникали младенческие колики. чем те, у кого нет мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter, тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium, но эта доля значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение Bifidobacterium spp. подсчитывать у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси) по сравнению с грудным вскармливанием.Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, находящимися на искусственном вскармливании, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17).Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда кишечник микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на применении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запоры, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, получавших L. reuteri, по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus, такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24). Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al.(25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium, включая штаммы Bifidobacterium breve, ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформные бактерии, выделенные у новорожденных с коликами (26). Другие исследования продемонстрировали эффективность штаммов B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al.(28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve в снижении риска некротического энтероколита у недоношенных детей (29, 30). Кроме того, два штамма B. breve B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32).Недавнее исследование также показало способность этих штаммов B. breve, используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью этого исследования было описать эффективность пробиотической композиции на основе B. breve, вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых фекальных микробных групп; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое исследование (NCT03219931), одобренное Этическим комитетом больницы Маджоре делла Карита (CE 63/13). Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0).Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на Рисунке 1. Их набирали, если они были здоровыми в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе.Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1). Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум. группы (рисунок 1).

Рисунок 1. Схема исследования.

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby ® (Probiotical S.p.A., Новара, Италия), содержащий B. breve, в течение 90 дней (T1), а группа плацебо получала состав плацебо в течение того же периода. Состав пробиотика представлял собой смесь 1: 1 двух штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленную в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 8 КОЕ каждый штамм.Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41).Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщить о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода. Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов стула

Образцы фекалий новорожденных собирали дважды: при включении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для экстракции ДНК. Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Извлечение ДНК из образцов фекалий

ДНК

экстрагировали из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием мини-набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола: дополнительная инкубация при 95 ° C. в течение 10 мин добавляли образец стула с буфером для лизиса для усиления разрыва бактериальных клеток (43). Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite ® 200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью Qubit ® 3.0 Флуорометр (Invitrogen, Life Technologies, Калифорния, США).

Абсолютное количественное определение выбранных микробных групп с помощью количественной ПЦР (кПЦР)

Количественная оценка выбранных групп или видов микробов, обычно отслеживаемых в исследованиях, связанных с младенцами (38, 43), например, Bidobacterium spp., Lactobacillus spp., Bacteroides fragilis group (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus), B. breve, Clostridium difficile, Escherichia coli и общие энтеробактерии проводили с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула.Анализы проводились с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR ® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (таблицы 1, 2), молекулярной степени чистоты H . 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2,5 нг / мкл. Анализ B. breve проводили с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5′-репортерным красителем 6-карбоксифлуоресцеином и 3 ‘тушитель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды).Количество циклов ПЦР — 40.

Таблица 1. Последовательности праймеров и условия кПЦР, использованные в различных анализах.

Таблица 2. Протоколы амплификации кПЦР и концентрации праймеров.

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44).Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации. Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы B.breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, E. coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin Extract II , MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию, измеренную спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию.Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками, равную 0.70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, мощностью 90% и уровнем значимости 95%, а также показателем отсева 20% в соответствии с опубликованными данными, уже доступными при разработке протокола (32). Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий.Базовые характеристики сравнивали с точным критерием Фишера для категориальных переменных и двухвыборочным t-критерием или t-критерием Велча, когда это необходимо для непрерывных переменных. Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2).Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание). Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики зарегистрированных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям отбора, и их родители приняли участие в исследовании.Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5). 158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рис. 1). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины.Кроме того, 139 новорожденных родились вагинальным путем, 10 — кесаревым сечением и 6 — оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать мам получили ИАП. Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице 3 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики).Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3. Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, были ли различия между младенцами на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача (p <0,05) и частота стула были выше (p <0,04), а эпизоды срыгивания были менее частыми (p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий (p <0,004), E. coli (p <0,03) и B. fragilis (p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании, также с поправкой на мешающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и количество дней жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотиков и плацебо

В таблице 4 показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо.Этот анализ показал значительное увеличение количества B. breve через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4. Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

После этой первой оценки и с учетом разного размера выборки новорожденных, вскармливаемых грудью и из бутылочки, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных, вскармливаемых грудью и из бутылочки.

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула (p <0,03) и меньшее количество энтеробактерий, чем в группе с пробиотиками (p <0,01), также с поправкой на вмешивающиеся факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату въезда). Предельные средние значения частоты стула и количества энтеробактерий составляют: 3,2 ± 0,4 против 4,3 ± 0,3 (p <0,01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г (p <0.03) соответственно.

Соблюдение режима лечения было высоким. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании. Из оставшихся 30 младенцев 7 получали искусственное вскармливание (5 — плацебо, 2 — пробиотик), а остальные 23 находились на смешанном вскармливании (11 — плацебо, 12 — пробиотик).

Клинические данные

Принимая во внимание клинические данные, количество минут плача (p <0,005) уменьшалось со временем без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени (p <0,0001), что оказывало влияние на лечение у тех, кто родился после 40 недель гестационного возраста (p <0,03). Консистенция стула с течением времени была больше 5-го типа по Бристольской таблице стула (p <0,03). Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула среди детей, получавших пробиотики (p <0.0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени (p <0,01) в группе, принимавшей пробиотики, в зависимости от группы плацебо, в соответствии с различным типом питания (p <0,03, рис. 2).

Рисунок 2. Количество ежедневных срыгиваний. Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (А); Новорожденные, находящиеся на искусственном вскармливании (B); Новорожденные на смешанном вскармливании (С). Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии (p <0.04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо (p <0,03). Более того, в течение 90 дней распространенность младенцев с коликами была одинаковой в группе плацебо (4 человека, 6,8%) и группе пробиотиков (6 человек, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования по сравнению с родившимися после кесарева сечения (p <0.03; Рисунок 3), а также у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования (p <0,005). Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании (p <0,01).

Рис. 3. Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (А); Новорожденные, рожденные путем кесарева сечения (B); Новорожденные, рожденные в результате оперативных родов (С). Данные выражены как предельное среднее значение ± стандартная ошибка среднего.Данные значимы во взаимодействии (p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

Таблица 5 описывает предельные средние модели 1. Дополнительная таблица 2 описывает также скорректированные модели.

Таблица 5. Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

Микробиологические данные

Всего энтеробактерий (p <0,005), Bifidobacterium spp. (p <0,001) и E.coli (p <0,001) изменилось со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменилась.

У тех, кто лечился пробиотиками, количество членов группы B. fragilis уменьшилось со временем у рожденных естественным путем, тогда как у других младенцев увеличилось (p <0,04). Более того, B. breve со временем увеличивалась у пациентов, получавших пробиотики (p <0,04). Микробиологические данные представлены в таблице 6.

Таблица 6. Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах кала новорожденных, вскармливаемых грудью.

Оценка данных лечения пробиотиками новорожденных, находящихся на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический (p <0,008). При поправке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и дни жизни на дату поступления), статистическая значимость была потеряна, тогда как количество B. fragilis было выше в группе пробиотиков (маргинальные средние 6,62 ± 0,53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания.Ни у одного ребенка в обеих группах не было коликов. Вес (p <0,0006), длина (p <0,01) и окружность головы (p <0,005) увеличивались со временем без эффекта лечения.

Микробиологические данные

Общее количество энтеробактерий и кишечной палочки не менялось с течением времени. Bifidobacterium spp. (p <0,02) и C. difficile увеличивались (p <0,04) со временем без эффекта от лечения. В группе, получавшей пробиотики, количество B. fragilis (p <0,03) уменьшилось, а B. breve увеличилось (p <0.03) соответственно со временем. Микробиологические данные представлены в таблице 7.

Таблица 7. Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследования in vitro подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve.

Исследование ясно показало способность вводимых штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение. В согласии с Lee et al.(13), снижение количества Lactobacillus наблюдалось во всех группах новорожденных с течением времени, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся применения бифидобактерий (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7-15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и количество E. coli были выше в бутылочках. вскармливаемых, чем новорожденных, вскармливаемых грудью, также с поправкой на искажающие факторы. Кроме того, на исходном уровне у детей, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis, что согласуется с более высоким риском инфекции, обычно наблюдаемым у детей, не вскармливаемых грудью (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve, по крайней мере, до отъема. .Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve является одним из самый распространенный вид в кишечнике новорожденного (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, т.е.е., срыгивание, рвота и запор — все это проблемы, с которыми трудно справиться лицам, осуществляющим уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков. Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками.Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании. Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, находившаяся на искусственном вскармливании, не имела достаточных возможностей для достижения клинических результатов.Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании время ежедневного плача младенцев не показало каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчетов, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного времени наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, другие мешающие факторы могут иметь значение после вторых месяцев жизни, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами из окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, изменяется количество Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные показывают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте. Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58).Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Более того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования — это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что вводимые штаммы B. breve могут попадать в кишечник здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. Сообщений о побочных эффектах не поступало, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Авторские взносы

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP выполнила статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, выполняя все исследования и разработки для Probiotical SpA, Новара, Италия.

Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fnut.2018.00039/full#supplementary-material

Список литературы

1. Savino F, Pelle E, Palumeri E, Oggero R, Miniero R. Lactobacillus reuteri (американский штамм коллекции типовых культур 55730) в сравнении с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. DOI: 10.1542 / педс.2006-1222

PubMed Аннотация | CrossRef Полный текст | Google Scholar

2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC.Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35.

PubMed Аннотация | Google Scholar

3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста. Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. DOI: 10.5223 / pghn.2017.20.1.1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

5. Вик Т., Гроте В., Эскрибано Дж., Соча Дж., Вердучи Э., Фритч М. и др.Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. DOI: 10.1111 / j.1651-2227.2009.01317.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров — рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. DOI: 10.1001 / jamapediatrics.2013.4367

PubMed Аннотация | CrossRef Полный текст | Google Scholar

7.Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. Связь между детской мигренью и детской коликой в ​​анамнезе. JAMA J Am Med Assoc. (2013) 309: 1607–12. DOI: 10.1001 / jama.2013.747

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr.(2015) 174: 841–2. DOI: 10.1186 / 1824-7288-39-15

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev. (2016) 12: 1–19. DOI: 10.1002 / 14651858.CD012473

CrossRef Полный текст | Google Scholar

10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника — это пластический фактор, реагирующий на изменения окружающей среды.Trends Microbiol. (2012) 20: 385–91. DOI: 10.1016 / j.tim.2012.05.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Дюбуа Н.Э., Грегори К.Е. Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. DOI: 10.1177 / 1099800415620840

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Ли С.А., Лим Дж.Й., Ким Б., Чо С.Дж., Ким Нью-Йорк, Бин Ким О, Ким Ю.Сравнение профиля кишечной микробиоты корейских младенцев, находящихся на грудном вскармливании и вскармливании смеси, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. DOI: 10.4162 / nrp.2015.9.3.242

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14. Маццола Г., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б. Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. DOI: 10.1371 / journal.pone.0157527

PubMed Аннотация | CrossRef Полный текст | Google Scholar

15.Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. DOI: 10.1503 / cmaj.130147

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Abrahamsson TR, Jakobsson HE, ersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие кишечной микробиоты у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. DOI: 10.1016 / j.jaci.2011.10.025

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. DOI: 10.1111 / apa.13642

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л.Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные ответы. Clin Exp Allergy (2006) 36: 1227–35. DOI: 10.1111 / j.1365-2222.2006.02553.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

20. Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102.DOI: 10.1111 / j.1365-2222.2007.02876.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у детей, находящихся на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование. J Pediatr. (2013) 162: 257–62. DOI: 10.1016 / j.jpeds.2012.08.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др.Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. DOI: 10.1016 / j.jpeds.2014.09.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. Пробиотики и здоровье кишечника у младенцев: предварительное наблюдательное исследование случай — контроль раннего лечения Lactobacillus reuteri DSM 17938.Clin Chim Acta (2015) 451: 82–7. DOI: 10.1016 / j.cca.2015.02.027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24. Савино Ф., Кордиско Л., Тараско В., Локателли Э., Ди Джоя Д., Оггеро Р. и др. Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев с коликами. BMC Microbiol. (2011) 11: 157. DOI: 10.1186 / 1471-2180-11-157

PubMed Аннотация | CrossRef Полный текст | Google Scholar

25. Ди Джоя Д., Алоизио I, Маццола Г.Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев. Appl Microbiol Biotechnol. (2014) 98: 563–77. DOI: 10.1007 / s00253-013-5405-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Алоизио I, Сантини С., Биавати Б., Динелли Дж., Ченчи А., Чингвару В. и др. Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. DOI: 10.1007 / s00253-012-4138-5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

27. Ли Й, Симидзу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении. Педиатрия Int. (2004) 46: 509–15. DOI: 10.1111 / j.1442-200x.2004.01953.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований.Поддержите лечение рака (2010) 18: 751–9. DOI: 10.1007 / s00520-009-0711-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

29. Костелое К., Харди П., Ющак Е., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных детей: рандомизированное контролируемое исследование фазы 3. Ланцет (2016) 387: 649–60. DOI: 10.1016 / s0140-6736 (15) 01027-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н.Преимущества приема Bifidobacterium breve M-16V у недоношенных новорожденных — ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. DOI: 10.1371 / journal.pone.0150775

PubMed Аннотация | CrossRef Полный текст | Google Scholar

31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей. J Clin Gastroenterol. (2014) 48: S37–9. DOI: 10.1097 / MCG.0000000000000234

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32.Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. Пробиотик Bifidobacterium breve B632 подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. DOI: 10.1155 / 2014/301053

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al. Влияние> Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование.Питательные вещества (2016) 8: 660–76. DOI: 10.3390 / nu8100660

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизация с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77. DOI: 10.1099 / mic.0.25975-0

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35.Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественное определение Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий грудных детей и детей, вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. DOI: 10.1016 / j.femsle.2004.11.052

PubMed Аннотация | CrossRef Полный текст | Google Scholar

36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественного определения патогенных и местных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. DOI: 10.1111 / j.1365-2672.2004.02409.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Е.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. DOI: 10.1016 / j.vetmic.2005.11.055

PubMed Аннотация | CrossRef Полный текст | Google Scholar

38.Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве. Педиатрия (2006) 118: 511–21. DOI: 10.1542 / педс.2005-2824

PubMed Аннотация | CrossRef Полный текст | Google Scholar

39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения видов фекальных Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol.(2005) 71: 2318–24. DOI: 10.1128 / AEM.71.5.2318-2324.2005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

40. Лезер Т.Д., Аменувор Дж. З., Йенсен Т. К., Линдекрона Р. Х., Бой М., Мёллер К. Независимый от культуры анализ кишечных бактерий: новый взгляд на микробиоту желудочно-кишечного тракта свиней. Appl Environ Microbiol. (2002) 68: 673–90. DOI: 10.1128 / AEM.68.2.673

PubMed Аннотация | CrossRef Полный текст | Google Scholar

42. пер. М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж.Надежность и обоснованность модифицированной шкалы бристольной формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. DOI: 10.1016 / j.jpeds.2011.03.002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

43. Алоизио И., Маццола Дж., Корвалья Л.Т., Тонти Дж., Фалделла Дж., Биавати Б. и др. Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium. Appl Microbiol Biotechnol.(2014) 98: 6051–60. DOI: 10.1007 / s00253-014-5712-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья. Фронт Педиатр. (2017) 5: 178. DOI: 10.3389 / fped.2017.00178

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт Х.Д.Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. DOI: 10.1046 / j.0014-2956.2001.02712.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте. Научный доклад (2017) 7: 11230. DOI: 10.1038 / s41598-017-10244-x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

50.Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. DOI: 10.1128 / AEM.68.1.219

PubMed Аннотация | CrossRef Полный текст | Google Scholar

51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev. (2017) 2: 1–224. DOI: 10.1002 / 14651858.CD001141

PubMed Аннотация | CrossRef Полный текст | Google Scholar

52.Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Дж. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. DOI: 10.1111 / cch.12454

PubMed Аннотация | CrossRef Полный текст | Google Scholar

53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 от детской колики: метаанализ рандомизированных контролируемых исследований.PLoS ONE (2015) 10: 1–16. DOI: 10.1371 / journal.pone.0141445

PubMed Аннотация | CrossRef Полный текст | Google Scholar

54. Магне Ф., Пучи Сильва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в развитие неинфекционных хронических заболеваний в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. DOI: 10.3389 / fped.2017.00192

PubMed Аннотация | CrossRef Полный текст | Google Scholar

55.Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ. Obes Rev. (2015) 16: 295–303. DOI: 10.1111 / obr.12267

PubMed Аннотация | CrossRef Полный текст | Google Scholar

56. De Moura EG, Lisboa PC, Passos MCF. Неонатальное программирование нейроиммуномодуляции — роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. DOI: 10.1159 / 000153422

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58.Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. Введение пробиотического продукта с множеством штаммов женщинам в перинатальном периоде по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных. рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. DOI: 10.3390 / nu8110677

PubMed Аннотация | CrossRef Полный текст | Google Scholar

59. Хертел С., Пагель Дж., Шпиглер Дж., Бума Дж., Хеннеке П., Виманн Д. и др.Пробиотики Lactobacillus acidophilus / Bifidobacterium infantis связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. DOI: 10.1038 / s41598-017-06161-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Парентеральные антибиотики уменьшают колонизацию и разнообразие бифидобактерий у новорожденных

Мы исследовали влияние парентерального лечения антибиотиками в раннем неонатальном периоде на эволюцию бифидобактерий у новорожденных.Были изучены девять младенцев, получавших внутривенный ампициллин / гентамицин в течение первой недели жизни, и девять детей контрольной группы (без лечения антибиотиками). Денатурирующий градиентный гель-электрофорез использовали для исследования состава Bifidobacterium в образцах стула, взятых через четыре и восемь недель. Бифидобактерии были обнаружены у всех младенцев контрольной группы как на четвертой, так и на восьмой неделях, в то время как только шесть из девяти младенцев, получавших лечение антибиотиками, имели обнаруживаемые бифидобактерии через четыре недели и восемь из девяти — через восемь недель.Более того, образцы стула контрольной группы показали большее разнообразие Bifidobacterium spp. по сравнению с младенцами, получавшими антибиотики. Таким образом, краткосрочное парентеральное лечение новорожденных антибиотиками вызывает нарушение ожидаемого характера колонизации бифидобактерий в первые месяцы жизни. Необходимы дальнейшие исследования пробиотиков для определения необходимости приема добавок в этой группе пациентов.

1. Введение

До 10% новорожденных нуждаются в госпитализации в отделение интенсивной терапии новорожденных (ОИТН) для оказания постоянной медицинской помощи [1–3].Многим из этих младенцев требуется лечение парентеральными антибиотиками в течение различных периодов времени. Известно, что введение антибиотиков нарушает состав кишечной микробиоты, что приводит к подавлению анаэробных бактерий (за исключением клостридий, которые остаются на обнаруживаемых уровнях) и увеличению числа потенциально патогенных бактерий, таких как Klebsiella, Enterobacter, Citrobacter и Pseudomonas [ 4, 5]. Поскольку новаторская микробиота младенчества, вероятно, создает для себя постоянную среду обитания, определяя пожизненный состав кишечной микробиоты и, следовательно, способствуя здоровью и благополучию хозяина [6, 7], начальная колонизация желудочно-кишечного тракта младенца имеет большое значение. важность.

Bifidobacterium spp. имеют несколько сообщений о влиянии на здоровье, включая подавление роста вредных бактерий, стимуляцию иммунной системы, облегчение запоров и профилактику кишечных инфекций [8–13]. Виды, обычно ассоциируемые с людьми, включают Bifidobacterium infantis, B. longum, B. bifidum, B. breve, B. catenulatum, B. pseudocatenulatum, B. angulatum, B. gallicum и B. adolescensis [8], из которых первые четыре распространены у младенцев [14].

Подавление популяции бифидобактерий, имевшее место после воздействия антибиотиков на детей [5, 15, 16], может оказывать негативное влияние на благополучие хозяина и может быть связано с более высокой восприимчивостью к энтеропатогенной бактериальной инфекции [17].Однако влияние парентеральных антибиотиков, назначаемых вскоре после рождения, на развивающуюся популяцию бифидобактерий, если таковое имеется, не изучалось. Поэтому целью этого исследования было определить влияние внутривенного лечения антибиотиками в неонатальном периоде на эволюцию колонизации бифидобактериями с течением времени.

2. Материалы и методы
2.1. Субъекты

Образцы фекалий были взяты с помощью мазков у 18 младенцев, девяти младенцев, ранее леченных антибиотиками, и девяти здоровых контролей (таблица 1).Протокол исследования был одобрен Комитетом по этике клинических исследований при клинических больницах Корка, Корк, Ирландия. Критерии включения были определены как доношенные или недоношенные дети, которым требовалось парентеральное введение антибиотиков в течение первых 48 часов жизни. Подходили контрольные субъекты, если они были доношенными или недоношенными младенцами, которые в остальном были здоровыми и не нуждались в госпитализации в ОИТН. Младенцы, получавшие пероральные антибиотики, дети, которых не принимали внутрь или нуждались в хирургическом вмешательстве, младенцы с врожденными аномалиями или родившиеся раньше срока, были исключены из исследования.Показания к лечению антибиотиками определялись клинически, на основании симптомов и / или признаков подозрения на сепсис и независимо от исследователей. Письменное информированное согласие было получено от родителей всех младенцев. Образцы стула были взяты одним и тем же врачом через четыре и восемь недель после рождения и сохранены при температуре C в ожидании анализа.

9077 907 907 907 907 907

907 907 9067 9067

907 L

N

9077 907 907 родоразрешение

9076 1


Образец Пол Кормление Лечение антибиотиками (дни) Тип антибиотиков M B + (9) Усилитель.+ Гент. Кесарево сечение
B M F + B + (5) Amp. + Гент. Кесарево сечение
C M B + (2) Amp. + Гент. Кесарево сечение
D M F + (2) Amp. + Гент. Роды через естественные родовые пути
E F F + (5) Amp.+ Гент. Кесарево сечение
F F B + (2) Amp. + Гент. Роды через естественные родовые пути
G F B + (2) Amp. + Гент. Роды через естественные родовые пути
H M F + (2) Amp. + Гент. Кесарево сечение
I M F + (2) Amp.+ Гент. Роды через естественные родовые пути
J M F Роды через естественные родовые пути
K M F F Вагинальные роды
M F F Вагинальные роды
Вагинальные роды
O F B Вагинальные роды
P B
Q M F Вагинальные роды
R F F Роды через естественные родовые пути

M, мужской; F, сука.Б, кормление грудью; F, кормление смесью. Усилитель. = ампициллин, Гент. гентамицин. близнецов.
2.2. Анализ ПЦР-DGGE

Бактериальную ДНК экстрагировали из мазков с использованием мини-набора для анализа ДНК QIAamp (Qiagen, Hilden, Германия), следуя инструкциям производителя (температура лизиса, ° C). Чтобы исследовать популяцию бифидобактерий в образцах, ПЦР была проведена как вложенный подход. В первой ПЦР применялись праймеры Im26-f (- GATTCTGGCTCAGGATGAACG -) и Im3-r (- CGGGTGCTICCCCACTTTCATG -), описанные Kaufmann et al.[18] амплифицировали фрагмент гена 16S рРНК бифидобактерий размером 1417 п.н. Объемы ПЦР 50 л содержали 5 л 10-кратного буфера для ПЦР, 5 л MgCl 2 (2,5 мМ), 8 л dNTP (0,2 мМ каждый), 1 л каждого праймера (5 пмоль), 0,5 л полимеразы Taq (5 Ед / л), 28,5 л стерильной воды Milli-Q и 1 л раствора ДНК. ПЦР-реагенты были получены от Bioline (Тонтон, Массачусетс, США). Использовали следующую программу ПЦР: начальная денатурация при C в течение 5 мин; 3 цикла денатурации при C в течение 45 с, отжиг при C в течение 2 минут и удлинение при 72 ° C в течение 1 минуты; 30 циклов денатурации при C в течение 20 с, отжига при C в течение 1 мин и удлинения при C в течение 1 мин; и окончательное удлинение при C в течение 5 мин с последующим охлаждением до C.Присутствие продуктов ПЦР проверяли на 1,5% (мас. / Об.) Агарозном геле. Чтобы удалить оставшиеся олигонуклеотиды и исходную матричную ДНК, очистку ампликонов проводили с использованием набора для очистки QIAquick PCR (Qiagen) в соответствии с инструкциями производителя. Вторую ПЦР проводили с использованием ампликонов первой ПЦР в качестве ДНК-матрицы. Используемый набор праймеров (F357-GC и 518R) (GC-clamp-GCCTACGGAGGCAGCAG — и — ATTACCGCGGCTGCTGG -, соответственно) амплифицирует область V3 бактериального гена 16S рРНК [19].Прямой праймер содержал зажим GC (- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGG -) для облегчения разделения ампликонов в геле DGGE. Объемы ПЦР 50 л содержали 5 л 10-кратного буфера для ПЦР, 2 л MgCl 2 (1 мМ), 8 л dNTP (0,2 мМ каждый), 2 л каждого праймера (5 M), 0,5 л Taq. полимеразы (5 Ед / л), 29,5 л стерильной воды Milli-Q и 1 л 10-кратно разведенного раствора ДНК (полученного в результате первой ПЦР). Использовалась следующая программа ПЦР: начальная денатурация при C в течение 5 мин, 30 циклов денатурации при C в течение 20 с, отжиг при C в течение 45 с, удлинение при C в течение 1 мин и окончательное удлинение при C в течение 7 мин, после путем охлаждения до С.Продукты ПЦР анализировали на гелях DGGE в соответствии с протоколом Temmerman et al. [10]. Использовали универсальную систему обнаружения мутаций Dcode (Bio-Rad Laboratories, Геркулес, Калифорния, США) с использованием гелей размером 16 см на 16 см на 1 мм. Были приготовлены восьмипроцентные полиакриламидные гели, которые обрабатывались с 1 × ТАЕ буфером, разбавленным 50 × ТАЕ буфером (2 М трис-основания, 1 М ледяная уксусная кислота и 50 мМ ЭДТА). Градиент денатурирования формировали с помощью двух исходных растворов 8% акриламида (акриламид-бис / акриламид 40%) (Severn Biotech Ltd, Вустершир, Великобритания).100% денатурирующий раствор содержал 40% (об. / Об.) Формамида и 7,0 М мочевины. Гели наливали сверху с помощью устройства для создания градиента (CBS Scientific Linear Gradient Maker, Bio-Rad Laboratories) и насоса (Bio-Rad Laboratories), и градиенты от 50% до 70% использовали для разделения образованных ампликонов. . Перед полимеризацией денатурирующего геля (градиентный объем 24 мл) добавляли укладывающийся гель объемом 6 мл без денатурирующих химикатов, а затем вставляли соответствующую гребенку. ПЦР-ампликоны разделяли электрофорезом при постоянном напряжении 60 В в токе 0.5 × ТАЕ буфер при постоянной температуре C в течение 16 часов. Гели окрашивали бромистым этидием в течение 30 мин, что позволяло получить цифровую фиксацию профилей полос DGGE в УФ-свете.

2.3. Контрольная лестница

Смесь пяти различных видов бифидобактерий, которые являются наиболее часто изолированными видами бифидобактерий из детского желудочно-кишечного тракта (ЖКТ) [14, 20, 21], была использована для создания контрольной лестницы для визуального сравнения. полос. Выделение ДНК из референсных штаммов Bifidobacterium breve, B.bifidum, B. infantis, B. adolescentis и B. longum, выполняли в соответствии с методом, описанным Hoffman и Winston [22].

3. Результаты

Девять субъектов были набраны как в контрольную группу, так и в группу, получавшую антибиотики, в этом исследовании. Соответствующие демографические данные суммированы в таблице 1. Хотя гендерное распределение и история кормления были одинаковыми в обеих группах, младенцы, получавшие антибиотики, с большей вероятностью родились путем кесарева сечения (5/9 младенцев), а все дети контрольной группы родились самопроизвольно. вагинальные роды.Ампициллин и гентамицин были единственными использованными антибиотиками, а средняя продолжительность терапии составляла 2 дня (диапазон 2–9 дней).

3.1. Развитие популяции бифидобактерий в возрасте четырех недель

Для исследования популяции бифидобактерий в образцах использовали праймеры, специфичные для бифидобактерий Im-3 и Im-26. Ампликоны, полученные с использованием этих праймеров, служили ДНК-матрицей для комбинации праймеров V3 V3R и V3F во время второй стадии ПЦР. Подвижность продуктов ПЦР, полученных с помощью этих праймеров в DGGE, сравнивали с паттерном ПЦР эталонных штаммов бифидобактерий.Из-за высокого содержания G + C бифидобактерий обычный денатурирующий градиент от 35% до 70% был заменен денатурирующим градиентом от 50% до 70%.

В возрасте четырех недель виды бифидобактерий были обнаружены у шести из девяти младенцев, получавших антибиотики (субъекты A – I), и у всех детей контрольной группы (субъекты J – R). Образцы младенцев, получавших лечение антибиотиками, показали меньшее количество полос в геле DGGE (рис. 1 (а)) по сравнению с контрольными образцами (рис. 1 (b)) в возрасте четырех недель, что представляет менее разнообразную популяцию бифидобактерий в этом возрасте. .У пяти из шести младенцев в группе, получавшей антибиотики, была обнаружена одна доминирующая полоса, которая соответствовала B. longum (рис. 1 (а)). Все пять младенцев получали внутривенное введение ампициллина / гентамицина в течение двух дней, и в этой группе были младенцы как на грудном вскармливании (субъект F, G), так и на искусственном вскармливании (субъект D, H, I). Образец без полосы в положении B. longum был получен от младенца, получавшего антибиотики в течение пяти дней (субъект E). Согласно структуре полос этого субъекта, некоторые виды Bifidobacterium смогли колонизировать этого младенца, несмотря на лечение антибиотиками в течение пяти дней; то есть нижняя полоса выглядит как B.bifidum, в то время как верхняя полоса не сопоставима ни с одним из видов в эталонной лестнице. Все образцы из контрольных животных, получавших смесь (K, L, M, Q, R), имели полосу в том же положении, что и B. longum в возрасте четырех недель, за исключением одного младенца (субъект J) (рисунок 1 (b)). . Напротив, образцы от грудных младенцев в контрольной группе (N, O, P) показали полосы в положениях B. infantis и B. bifidum. Эти два вида были обнаружены только у одного из младенцев, вскармливаемых смесью. В то время как все младенцы, рожденные естественным путем в группе, получавшей лечение антибиотиками, к четырехнедельному возрасту содержали бифидобактерии, двое из пяти младенцев, рожденных с помощью кесарева сечения, содержали бифидобактерии (B.bifidum и B. longum) в этот момент времени.

3.2. Развитие популяции бифидобактерий в возрасте восьми недель

В возрасте восьми недель восемь из девяти младенцев, получавших антибиотики, и все контрольные группы имели определяемые уровни бифидобактерий в стуле. Интересно, что единственный образец, в котором не были обнаружены бифидобактерии, был взят у младенца, получавшего антибиотики в течение девяти дней (субъект A) (других младенцев лечили антибиотиками в течение 2–5 дней). Между четырьмя и восьмью неделями наблюдалось увеличение разнообразия бифидобактерий в обеих группах, о чем свидетельствует увеличение количества полос (рис. 2).Тем не менее, хотя обе группы были схожими через восемь недель, образцы от младенцев, получавших антибиотики, продолжали демонстрировать менее разнообразную популяцию бифидобактерий по сравнению с контрольной группой (рис. 2). Образцы, полученные от детей, находящихся на грудном вскармливании, в контрольной группе в целом имели более разнообразную популяцию бифидобактерий по сравнению с детьми, вскармливаемыми смесью (7-8 диапазонов по сравнению с 2-5 диапазонами, соответственно). Однако никаких различий между образцами от детей, вскармливаемых грудью и вскармливаемых смесью, в группах, получавших антибиотики, не наблюдалось.Субъект G продемонстрировал уменьшение разнообразия в возрасте от четырех до восьми недель. Более того, полоса с максимальной интенсивностью через четыре недели, обозначенная как B. longum, была заменена другим доминирующим штаммом, обозначенным как B. breve, через восемь недель. Четверо из пяти младенцев в группе, получавшей лечение антибиотиками, рожденных путем кесарева сечения, к восьмой неделе уже имели бифидобактерии. Как было обнаружено на четвертой неделе, все младенцы, рожденные естественным путем, имели бифидобактерии в возрасте восьми недель, при этом наблюдались более высокие различия по сравнению с четырехнедельным возрастом.В целом, B. longum оказался наиболее часто обнаруживаемым видом Bifidobacterium у младенцев на восьмой неделе жизни (присутствует у 15 из 17 младенцев, являющихся носителями бифидобактерий) (рис. 2).

4. Обсуждение

Виды Bifidobacterium и Lactobacillus считаются одними из наиболее важных полезных бактерий в ЖКТ человека, и их присутствие в большом количестве в микробиоте считается полезным [23, 24]. Подавление этих полезных компонентов может способствовать росту потенциально патогенных бактерий, таких как Klebsiella и Clostridium, и иметь последствия для благополучия хозяина.Это исследование демонстрирует, что даже кратковременное парентеральное лечение антибиотиками со временем меняет характер эволюции бифидобактерий. Младенцы, получавшие антибиотики, показали снижение как колонизации, так и разнообразия бифидобактерий по сравнению с контрольной группой. В то время как контрольная группа и группы, получавшие лечение антибиотиками, были схожими к восьминедельному возрасту, ряд контрольных субъектов продолжали демонстрировать более разнообразную популяцию бифидобактерий. Mackie et al. [25] сообщили, что колонизация бифидобактериями у младенцев обычно хорошо устанавливается к недельному возрасту.Возникает соблазн предположить, что наблюдаемая разница в обнаруживаемых уровнях бифидобактерий между младенцами, получавшими антибиотики, и контрольной группой в нашем исследовании отражает раннее воздействие антибиотиков. Favier et al. [26] ранее описали значительную разницу в микробиоте одного младенца, получавшего антибиотики, по сравнению с четырьмя младенцами, не получавшими антибиотики, используя аналогичную методологию, то есть праймеры, специфичные для ПЦР-DGGE и Bifidobacterium, которые использовались в нашем исследовании. Bifidobacterium spp. отсутствовали у младенца, получавшего антибиотики, во все оцениваемые моменты времени, от пяти дней до пяти месяцев.Однако в этом исследовании субъект, получавший антибиотики, получал длительную антибактериальную терапию как парентеральными, так и пероральными агентами (тринадцать дней парентерального введения коамоксиклава с последующим пероральным приемом котримоксазола) [26]. Напротив, у большинства участников нашего исследования были относительно короткие периоды внутривенного введения антибиотиков, но все же различия наблюдались по сравнению с контрольной группой.

B. longum был доминирующим видом как у младенцев, получавших антибиотики, так и в контрольной группе.Этот вывод согласуется с исследованием Grönlund et al. [27], которые обнаружили, что B. longum является наиболее распространенным видом Bifidobacterium, присутствующим у младенцев. B. longum также был наиболее распространенным видом у младенцев, получавших антибиотики. Этот результат коррелирует с недавним открытием Mättö et al. [14], демонстрируя, что B. longum имеет более высокую минимальную ингибирующую концентрацию (MIC) для ампициллина по сравнению с другими видами Bifidobacterium. Таким образом, кажется, что лечение антибиотиками могло быть выбрано для этого вида.Один ребенок показал уменьшение количества видов с трех видов в возрасте четырех недель до одного вида в возрасте восьми недель. Виды, которые показали самую высокую интенсивность в геле DGGE через четыре недели, были заменены другим доминирующим видом через восемь недель. Эти результаты согласуются с исследованием Favier et al. [26], в котором первоначально доминирующие бифидобактерии у двух младенцев были заменены после появления новых видов в течение периода исследования.

Хотя менее половины младенцев в этом исследовании находились на грудном вскармливании, наше исследование подтверждает предыдущие сообщения о том, что грудное вскармливание положительно связано с более разнообразной популяцией бифидобактерий по сравнению с младенцами, находящимися на искусственном вскармливании [16, 28, 29].Виды Bifidobacterium считаются одними из важнейших полезных бактерий ЖКТ человека [18, 19, 24]. Более высокая плотность полезных бактерий у младенцев может обеспечить определенную защиту от детских болезней. Например, колонизация бифидобактериями связана с более низким риском атопии [21, 30, 31]. В проспективном исследовании дети с меньшим количеством фекальных бифидобактерий и повышенным количеством клостридий с первых недель жизни имели больше шансов стать сенсибилизированными к обычным аллергенам [23].Кроме того, сообщалось, что различия в микробиоте кишечника в младенчестве могут предшествовать развитию ожирения. В этом исследовании Kalliomäki et al. [32], количество Bifidobacterium spp. были выше в младенчестве у детей с нормальным весом, чем у детей с избыточным весом. Такие факторы, как грудное вскармливание, вагинальные роды и отсутствие воздействия антибиотиков, будут способствовать микробному разнообразию с большим количеством бифидобактерий.

В заключение, настоящее исследование демонстрирует, что краткосрочное парентеральное лечение новорожденных антибиотиками вызывает нарушение ожидаемого паттерна колонизации бифидобактериями в первые месяцы жизни.Может ли задержка колонизации бифидобактериями отрицательно повлиять на состояние здоровья в младенчестве или в более позднем возрасте, остается неизвестным. Тем не менее, для дальнейшего понимания последствий раннего неонатального введения антибиотиков необходимы проспективные исследования с достаточной мощностью, которые документируют изменения в микробиоте и включают долгосрочные результаты состояния здоровья. Пока такие данные не доступны, прием бифидобактерий в этой группе пациентов не может быть оправдан.

Сокращения
DGGE: Денатурирующий градиентный гель-электрофорез
GIT: Желудочно-кишечный тракт
MIC:
Минимальная ингибирующая концентрация в отделении интенсивной терапии
Благодарности

Эта работа частично финансировалась фондами Научного фонда Ирландии (SFI), Enterprise Ireland и правительством Ирландии в соответствии с Национальным планом развития на 2000–2006 годы.

Добавка с пробиотиками восстанавливает нормальный состав и функцию микробиоты у младенцев, получавших лечение антибиотиками, и у младенцев, родившихся после кесарева сечения | Microbiome

  • 1.

    Milani C, Duranti S, Bottacini F, Turroni F, Mahony J, et al. Первые микробные колонизаторы кишечника человека: состав, деятельность и последствия для здоровья микробиоты кишечника младенца.Microbiol Mol Biol Rev.2017; 81 (4). https://doi.org/10.1128/MMBR.00036-17.

  • 2.

    Korpela K, Costea P, Coelho LP, Kandels-Lewis S, Willemsen G, Boomsma DI, et al. Селективный материнский посев и окружающая среда формируют микробиом кишечника человека. Genome Res. 2018; 28 (4): 561–8.

    CAS
    Статья

    Google ученый

  • 3.

    Крауткрамер К.А., Крезнар Дж.Х., Романо К.А., Вивас Е.Л., Баррет-Уилт Г.А., Рабалья М.Э. и др. Взаимодействие диеты и микробиоты опосредует глобальное эпигенетическое программирование во многих тканях хозяина.Mol Cell. 2016; 64: 982–92.

    CAS
    Статья

    Google ученый

  • 4.

    Maynard CL, Elson CO, Hatton RD, Weaver CT. Взаимное взаимодействие кишечной микробиоты и иммунной системы. Природа. 2012; 489: 231–41.

    CAS
    Статья

    Google ученый

  • 5.

    Генсоллен Т., Айер С.С., Каспер Д.Л., Блумберг Р.С. Как колонизация микробиотой в раннем возрасте формирует иммунную систему.Наука. 2016; 352: 539–44.

    CAS
    Статья

    Google ученый

  • 6.

    Blanton LV, Charbonneau MR, Salih T., Barratt MJ, Venkatesh S, Ilkaveya O, et al. Кишечные бактерии, предотвращающие нарушение роста, передаваемое микробиотой от недоедающих детей. Наука. 2016; 351: aad3311.

    Артикул

    Google ученый

  • 7.

    Биазуччи Дж., Рубини М., Рибони С., Морелли Л., Бесси Е., Рететангос К.Способ доставки влияет на бактериальное сообщество в кишечнике новорожденного. Early Hum Dev. 2010; 86: 13–5.

    Артикул

    Google ученый

  • 8.

    Домингес-Белло М.Г., Костелло Е.К., Контрерас М., Магрис М., Идальго Г., Фирер Н. и др. Способ доставки формирует приобретение и структуру исходной микробиоты в различных средах обитания новорожденных. Proc Natl Acad Sci. 2010; 107: 11971–5.

    Артикул

    Google ученый

  • 9.

    Bäckhed F, Roswall J, Peng Y, Feng Q, Jia H, Kovatcheva-Datchary P, et al. Динамика и стабилизация микробиома кишечника человека в течение первого года жизни. Клеточный микроб-хозяин. 2015; 17: 690–703.

    Артикул

    Google ученый

  • 10.

    Персо Р., Азад Б., Конья Т., Гутман Д., Чари Р., Сирс М. и др. Влияние перинатального воздействия антибиотиков на микробиоту кишечника младенца в возрасте одного года. Allergy Asthma Clin Immunol. 2014; 10: А31.

    Артикул

    Google ученый

  • 11.

    Korpela K, Salonen A, Virta LJ, Kekkonen RA, de Vos WM. Связь использования антибиотиков в раннем возрасте и защитные эффекты грудного вскармливания: роль кишечной микробиоты. JAMA Pediatr. 2016; 170 (8): 750–7.

    Артикул

    Google ученый

  • 12.

    Мюллер Н.Т., Уайатт Р., Хёпнер Л., Оберфилд С., Домингес-Белло М.Г., Виден Е.М. и др.Пренатальное воздействие антибиотиков, кесарево сечение и риск детского ожирения. Int J Obes. 2015; 39: 665–70.

    CAS
    Статья

    Google ученый

  • 13.

    Саари А., Вирта Л.Дж., Санкилампи У., Дункель Л., Саксен Х. Воздействие антибиотиков в младенчестве и риск избыточного веса в первые 24 месяца жизни. Педиатрия. 2015; 135: 617–26.

    Артикул

    Google ученый

  • 14.

    Багер П., Вольфарт Дж., Вестергард Т. Кесарево сечение и риск атопии и аллергических заболеваний: метаанализы. Clin Exp Allergy. 2008; 38: 634–42.

    CAS
    Статья

    Google ученый

  • 15.

    van Nimwegen FA, Penders J, Stobberingh EE, Postma DS, Koppelman GH, Kerkhof M, et al. Способ и место родов, микробиота желудочно-кишечного тракта и их влияние на астму и атопию. J Allergy Clin Immunol. 2011; 128: 948–55.

    Артикул

    Google ученый

  • 16.

    Cardwell C, Stene L, Joner G, Cinek O, Scensson J, Goldacre MJ и др. Кесарево сечение связано с повышенным риском развития сахарного диабета 1 типа в детстве: метаанализ обсервационных исследований. Диабетология. 2008. 51: 726–35.

    CAS
    Статья

    Google ученый

  • 17.

    Hviid A, Svanstrom H, Frisch M. Использование антибиотиков и воспалительные заболевания кишечника в детстве. Кишечник. 2011; 60: 49–54.

    Артикул

    Google ученый

  • 18.

    Вирта Л., Аувинен А., Хелениус Х, Хуовинен П., Колхо К. Связь повторяющегося воздействия антибиотиков с развитием болезни Крона у детей — общенациональное финское исследование методом случай-контроль на основе регистров. Am J Epidemiol. 2012; 175: 775–84.

    Артикул

    Google ученый

  • 19.

    Рассел С.Л., Голд М.Дж., Хартманн М., Виллинг Б.П., Торсон Л., Влодарска М. и др. Изменения микробиоты в раннем возрасте, вызванные приемом антибиотиков, повышают восприимчивость к аллергической астме.EMBO Rep. 2012; 13: 440–7.

    CAS
    Статья

    Google ученый

  • 20.

    Кокс Л.М., Яманиши С., Сон Дж., Алексеенко А.В., Леунг Дж. М., Чо И. и др. Изменение кишечной микробиоты во время критического периода развития имеет долгосрочные метаболические последствия. Клетка. 2014; 158: 705–21.

    CAS
    Статья

    Google ученый

  • 21.

    Бергус Г.Р., Леви Б.Т., Леви С.М., Слагер С.Л., Кирицы М.Ц.Использование антибиотиков в течение первых 200 дней жизни. Arch. Fam. Med. 1996; 5: 523–6.

    CAS
    Статья

    Google ученый

  • 22.

    Betrán AP, Ye J, Moller AB, Zhang J, Gülmezoglu AM, Torloni MR. Тенденция к увеличению частоты кесарева сечения: глобальные, региональные и национальные оценки: 1990-2014 гг. PLoS One. 2016; 11: e0148343.

    Артикул

    Google ученый

  • 23.

    Corrêa NB, Péret Filho LA, Penna FJ, Lima FMS, Nicoli JR.Рандомизированное контролируемое исследование Bifidobacterium lactis и Streptococcus thermophilus для профилактики диареи, связанной с приемом антибиотиков, у младенцев. J Clin Gastroenterol. 2005; 39: 385–9.

    Артикул

    Google ученый

  • 24.

    Куйтунен М., Кукконен К., Юнтунен-Бакман К., Корпела Р., Пусса Т., Тууре Т. и др. Пробиотики предотвращают IgE-ассоциированную аллергию до 5 лет у детей, родившихся после кесарева сечения, но не во всей когорте.J Allergy Clin Immunol. 2009; 123: 335–41.

    Артикул

    Google ученый

  • 25.

    Lombard V, Golaconda Ramulu H, Drula E, Coutinho PM, Henrissat B. База данных по углеводно-активным ферментам (CAZy) в 2013 г. Nucleic Acids Res. 2013; 42: D490–5.

    Артикул

    Google ученый

  • 26.

    Джеймс К., Мазеруэй М.О., Боттачини Ф., Ван Синдерен Д. Bifidobacterium breve UCC2003 метаболизирует олигосахариды грудного молока лакто-N-тетраозу и лакто-N-нео-тетраозу через перекрывающиеся, но разные пути.Научный доклад 2016; 6: 38560.

    CAS
    Статья

    Google ученый

  • 27.

    Coppa GV, Gabrielli O, Pierani P, Catassi C, Carlucci A, Giorgi PL. Изменения углеводного состава грудного молока за 4 месяца лактации. Педиатрия. 1993; 91: 637–41.

    CAS
    PubMed

    Google ученый

  • 28.

    Thurl S, Müller-Werner B, Sawatzki G. Количественное определение отдельных олигосахаридных соединений из грудного молока с использованием анионообменной хроматографии с высоким pH.Анальная биохимия. 1996. 235: 202–6.

    CAS
    Статья

    Google ученый

  • 29.

    Kent JC, Mitoulas LR, Cregan MD, Ramsay DT, Doherty DA, Hartmann PE. Объем и частота кормлений грудью, а также жирность грудного молока в течение дня. Педиатрия. 2006; 117: 387–95.

    Артикул

    Google ученый

  • 30.

    Моро Г., Миноли I, Моска М., Фанаро С., Елинек Дж., Шталь Б. и др.Связанные с дозировкой бифидогенные эффекты галакто- и фруктоолигосахаридов у доношенных детей, находящихся на искусственном вскармливании. J Pediatr Gastroenterol Nutr. 2002; 34: 291–5.

    CAS
    Статья

    Google ученый

  • 31.

    Ринне М., Геймонд М., Каллиомяки М., Хоппу Ю., Салминен С.Дж., Исолаури Э. Сходные бифидогенные эффекты частично гидролизованной детской смеси с пребиотиками и грудного вскармливания на микробиоту кишечника младенца. FEMS Immunol Med Microbiol. 2005; 43: 59–65.

    CAS
    Статья

    Google ученый

  • 32.

    Руис-Мояно С., Тоттен С., Гарридо Д., Смиловиц Дж., Герман Дж., Лебрилла С. и др. Изменения в потреблении олигосахаридов грудного молока младенческими кишечными штаммами Bifidobacterium breve. Прил. Environ. Microbiol. 2013; 79: 6040–9.

    CAS
    Статья

    Google ученый

  • 33.

    Дуйяр Ф.П., Риббера А., Кант Р., Пиетила Т., Ярвинен Х., Мессинг М. и др.Сравнительный геномно-функциональный анализ 100 штаммов Lactobacillus rhamnosus и их сравнение со штаммом GG. PLoS Genet. 2013; 9: e1003683.

    CAS
    Статья

    Google ученый

  • 34.

    Моллой А.М., Кирк П.Н., Броди Л.С., Скотт Дж. М., Миллс Дж. Л.. Влияние дефицита фолиевой кислоты и витамина B12 во время беременности на развитие плода, младенца и ребенка. Еда Nutr Bull. 2008; 29: 101–11.

    Артикул

    Google ученый

  • 35.

    Дегучи Ю., Моришита Т., Мутаи М. Сравнительные исследования синтеза водорастворимых витаминов среди человеческих видов бифидобактерий. Agric Biol Chem. 1985; 49: 13–9.

    CAS

    Google ученый

  • 36.

    Краузе Л.Дж., Форсберг С.В., Коннор Д.Л. Кормление крыс грудным молоком увеличивает количество бифидобактерий в слепой и толстой кишке, что коррелирует с повышенным статусом фолиевой кислоты. J Nutr. 1996; 126: 1505.

    CAS
    Статья

    Google ученый

  • 37.

    Pompei A, Cordisco L, Amaretti A, Zanoni S, Raimondi S, Matteuzzi D, et al. Введение бифидобактерий, продуцирующих фолат, улучшает статус фолиевой кислоты у крыс Wistar. J Nutr. 2007. 137: 2742–6.

    CAS
    Статья

    Google ученый

  • 38.

    Penders J, Thijs C, Vink C, Stelma FF, Snijders B., Kummeling I, et al. Факторы, влияющие на состав кишечной микробиоты в раннем детстве. Педиатрия. 2006; 118: 511–21.

    Артикул

    Google ученый

  • 39.

    Penders J, Gerhold K, Stobberingh EE, Thijs C, Zimmermann K, Lau S и др. Установление кишечной микробиоты и ее роль в развитии атопического дерматита в раннем детстве. J Allergy Clin Immunol. 2013; 132: 601–7.

    Артикул

    Google ученый

  • 40.

    Домингес-Белло М.Г., Хесус-лаби К., Шен Н., Кокс Л., Амир А., Гонсалес А. и др. Частичное восстановление микробиоты младенцев, рожденных после кесарева сечения, посредством вагинального микробного переноса.Nat. Med. 2016; 22: 250–3.

    CAS
    Статья

    Google ученый

  • 41.

    Madan JC, Hoen AG, Lundgren SN, Farzan SF, Cottingham KL, Morrison HG, et al. Связь кесарева сечения и добавления смеси с кишечным микробиомом 6-недельных младенцев. Педиатрия JAMA. 2016; 170: 212–9.

    Артикул

    Google ученый

  • 42.

    Чу Д.М., Ма Дж., Принц А.Л., Энтони К.М., Сеферович М.Д., Аагаард К.М.Созревание структуры и функции сообщества микробиома младенца во многих участках тела и в зависимости от способа доставки. Nat Med. 2017; 23: 314–26.

    CAS
    Статья

    Google ученый

  • 43.

    Sordillo JE, Zhou Y, McGeachie MJ, Ziniti J, Lange N, Laranjo N, et al. Факторы, влияющие на микробиом кишечника младенцев в возрасте 3-6 месяцев: результаты исследования по снижению антенатальной астмы с участием различных этнических групп (VDAART).J Allergy Clin Immunol. 2017; 139: 482–91 e14.

    Артикул

    Google ученый

  • 44.

    Равель Дж., Гайер П., Абдо З., Шнайдер Г.М., Кениг С.С., МакКулле С.Л. и др. Микробиом влагалища женщин репродуктивного возраста. Proc Natl Acad Sci U S. A. 2011; 108: 4680–7.

    CAS
    Статья

    Google ученый

  • 45.

    Каннингтон А.Дж., Сим К., Дайерл А., Кролл Дж., Брэнниган Э., Дарби Дж. «Вагинальный посев» младенцев, рожденных с помощью кесарева сечения.BMJ. 2016; 352: i227.

    Артикул

    Google ученый

  • 46.

    Björkstén B, Sepp E, Julge K, Voor T., Mikelsaar M. Развитие аллергии и кишечная микрофлора в течение первого года жизни. J Allergy Clin Immunol. 2001; 108: 516–20.

    Артикул

    Google ученый

  • 47.

    Kalliomäki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. Отчетливые образцы микрофлоры кишечника новорожденных у младенцев, у которых атопия развивалась и не развивалась.J Allergy Clin Immunol. 2001; 107: 129–34.

    Артикул

    Google ученый

  • 48.

    Li N, Russell WM, Douglas-esobar M, Hauser N, Lopez M, Neu J. Живые и убитые нагреванием Lactobacillus rhamnosus GG: влияние на провоспалительные и противовоспалительные цитокины / хемокины у грудных детей, вскармливаемых гастростомией крысы. Pediatr Res. 2009; 66: 203–7.

    CAS
    Статья

    Google ученый

  • 49.

    Чон С.Г., Каяма Х., Уэда Й., Такахаши Т., Асахара Т., Цуджи Х. и др. Пробиотик Bifidobacterium breve индуцирует продуцирующие IL-10 клетки Tr1 в толстой кишке. PLoS Pathog. 2012; 8: e1002714.

    CAS
    Статья

    Google ученый

  • 50.

    Pohjavuori E, Viljanen M, Korpela R, Kuitunen M, Tiittanen M, Vaarala O, et al. Эффект Lactobacillus GG в увеличении продукции IFN-γ у младенцев с аллергией на коровье молоко. J Allergy Clin Immunol. 2004. 114: 131–6.

    CAS
    Статья

    Google ученый

  • 51.

    Вильянен М., Савилахти Е., Хахтела Т., Юнтунен-Бакман К., Корпела Р., Пусса Т. и др. Пробиотики в лечении синдрома атопической экземы / дерматита у младенцев: двойное слепое плацебо-контролируемое исследование. Аллергия. 2005; 60: 494–500.

    CAS
    Статья

    Google ученый

  • 52.

    He F, Ouwehand A, Isolauri E, Hashimoto H, Benno Y, Salminen S.Сравнение адгезии слизистой оболочки и видовая идентификация бифидобактерий, выделенных от здоровых и аллергических младенцев. FEMS Immunol Med Microbiol. 2001; 30: 43–7.

    CAS
    Статья

    Google ученый

  • 53.

    Korpela K, Salonen A, Virta L, Kumpu M, Kekkonen R, de Vos W. Потребление Lactobacillus rhamnosus GG изменяет микробиоту кишечника детей дошкольного возраста, смягчает изменения, связанные с пенициллином, и снижает использование антибиотиков. PLoS One.2016; 11: e0154012.

    Артикул

    Google ученый

  • 54.

    Пламмер С.Ф., Гараиова И., Сарвотэм Т., Коттролл С.Л., Ле Скуиллер, Уивер М.А. и др. Влияние пробиотиков на состав кишечной микробиоты после антибактериальной терапии. Int J Antimicrob Agents. 2005; 26: 69–74.

    CAS
    Статья

    Google ученый

  • 55.

    Myllyluoma E, Ahlroos T, Veijola L, Rautelin H, Tynkkynen S, Korpela R.Влияние лечения против Helicobacter pylori и добавок пробиотиков на кишечную микробиоту. Int J Antimicrob Agents. 2007; 29: 66–72.

    CAS
    Статья

    Google ученый

  • 56.

    Энгельбректсон А., Корзеник Дж. Р., Питтлер А., Сандерс М. Е., Клаенхаммер Т. Р., Лейер Г. и др. Пробиотики, чтобы свести к минимуму нарушение фекальной микробиоты у здоровых людей, получающих антибактериальную терапию. J Med Microbiol. 2009. 58: 663–70.

    CAS
    Статья

    Google ученый

  • 57.

    Myllyluoma E, Veijola L, Ahlroos T, Tynkkynen S, Kankuri E, Vapaatalo H, et al. Добавление пробиотиков улучшает переносимость эрадикационной терапии Helicobacter pylori — плацебо-контролируемое двойное слепое рандомизированное пилотное исследование. Алимент. Pharmacol. Ther. 2005; 21: 1263–72.

    CAS
    Статья

    Google ученый

  • 58.

    Brunser O, Gotteland M, Cruchet S, Figueroa G, Garrido D, Steenhout P. Влияние молочной смеси с пребиотиками на кишечную микробиоту младенцев после лечения антибиотиками.Pediatr Res. 2006; 59: 451–6.

    Артикул

    Google ученый

  • 59.

    Salonen A, Nikkilä J, Jalanka-Tuovinen J, Immonen O, Rajilić-Stojanović M, Kekkonen RA, et al. Сравнительный анализ методов выделения фекальной ДНК с филогенетическим микрочипом: эффективное восстановление бактериальной и архейной ДНК с помощью механического лизиса клеток. J Microbiol Methods. 2010. 81: 127–34.

    CAS
    Статья

    Google ученый

  • 60.

    Kolmeder CA, de Been M, Nikkilä J, Ritamo I, Mättö J, Valmu L, et al. Сравнительный анализ метапротеомики и разнообразия кишечной микробиоты человека свидетельствует о ее временной стабильности и выражении основных функций. PLoS One. 2010; 7: e29913.

    Артикул

    Google ученый

  • 61.

    Kolmeder CA, Salojärvi J, Ritari J, de Been M, Raes J, Falony G, et al. Фекальный метапротеомный анализ показывает персонализированный и стабильный функциональный микробиом и ограниченные эффекты пробиотического вмешательства у взрослых.PLoS One. 2016; 11: e0153294.

    Артикул

    Google ученый

  • 62.

    Корпела, К. Маре: Анализ микробиоты в R легко. Пакет R версии 1.0. 2016.

  • 63.

    Эдгар Р.С. Поиск и кластеризация на порядки быстрее, чем BLAST. Биоинформатика. 2010; 26: 2460–1.

    CAS
    Статья

    Google ученый

  • 64.

    Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T., Yarza P, et al.Проект базы данных генов рибосомных РНК SILVA: улучшенная обработка данных и веб-инструменты. Nucleic Acids Res. 2012; 41: D590–6.

    Артикул

    Google ученый

  • 65.

    Truong DT, Franzosa EA, Tickle TL, Scholz M, Weingart G, Pasolli E, et al. MetaPhlAn2 для расширенного метагеномного таксономического профилирования. Нат методы. 2015; 12: 902–3.

    CAS
    Статья

    Google ученый

  • 66.

    Oksanen, J. et al. веганский: Пакет «Экология сообщества». Пакет R версии 2.0-6. 2013.

  • 67.

    Венейблс В., Рипли Б. Современная прикладная статистика с С. Нью-Йорк: Спрингер; 2002.

    Google ученый

  • 68.

    Пинейро, Дж., Бейтс, Д., Деброй, С., Саркар, Д. и основная группа разработчиков R. nlme: линейные и нелинейные модели смешанных эффектов. Пакет R версии 3.1-108. 2013.

  • 69.

    Korpela K, Blakstad EW, Moltu S, Strommen K, Nakstad B, Ronnestad, et al.Развитие кишечной микробиоты и гестационный возраст у недоношенных новорожденных. Научный отчет 2018; 8: 2453.

    Артикул

    Google ученый

  • Польза для здоровья, использование, побочные эффекты, дозировка и взаимодействие

    Abe, F., Muto, M., Yaeshima, T., Iwatsuki, K., Aihara, H., Ohashi, Y., and Fujisawa, T. Оценка безопасности пробиотических бифидобактерий путем анализа активности разложения муцина и способности к транслокации .Анаэроб. 2010; 16 (2): 131-136. Просмотреть аннотацию.

    Акацу, Х., Ивабути, Н., Сяо, Дж. З., Мацуяма, З., Курихара, Р., Окуда, К., Ямамото, Т., и Маруяма, М. Клинические эффекты пробиотических бактерий Bifidobacterium longum BB536 на иммунную систему. Функция и кишечная микробиота у пожилых пациентов, получающих энтеральное зондовое питание. JPEN J Parenter Enteral Nutr 11-27-2012; Просмотреть аннотацию.

    Андраде, С. и Борхес, Н. Влияние ферментированного молока, содержащего Lactobacillus acidophilus и Bifidobacterium longum, на липиды плазмы женщин с нормальным или умеренно повышенным холестерином.J.Dairy Res. 2009; 76 (4): 469-474. Просмотреть аннотацию.

    Арая-Кодзима Томоко, Яэшима Томоко Исибаши Норио Симамура Сейичи Хаясава Хиротоши. Ингибирующее действие Bifidobacterium longum BB536 на вредные кишечные бактерии. Бифидобактерии Microflora 1995; 14 (2): 59-66.

    Ballongue J, Grill J Baratte-Euloge P. Экшн по цвету кишечных ферментов с бифидобактериями. Lait 1993; 73: 249-256.

    Беннет Р., Норд К. Э. и Зеттерстром Р. Временная колонизация кишечника новорожденных младенцев перорально вводимыми бифидобактериями и лактобактериями.Acta Paediatr. 1992; 81 (10): 784-787. Просмотреть аннотацию.

    Берчик П., Парк, А.Дж., Синклер, Д., Хошдел, А., Лу, Дж., Хуанг, X., Дэн, Ю., Бленнерхассет, Пенсильвания, Фанесток, М., Мойн, Д., Бергер, Б., Хейзинга, Дж. Д., Кунце, В., Маклин, П. Г., Бергонзелли, Г. Е., Коллинз, С. М. и Верду, Е. Ф. Анксиолитический эффект Bifidobacterium longum NCC3001 включает вагусные пути для связи кишечника с мозгом. Нейрогастроэнтерол.Мотил. 2011; 23 (12): 1132-1139. Просмотреть аннотацию.

    Чалла, А., Rao, D. R., Chawan, C. B. и Shackelford, L. Bifidobacterium longum и лактулоза подавляют индуцированные азоксиметаном аберрантные очаги крипт толстой кишки у крыс. Канцерогенез 1997; 18 (3): 517-521. Просмотреть аннотацию.

    Chouraqui, JP, Grathwohl, D., Labaune, JM, Hascoet, JM, de, Montgolfier, I, Leclaire, M., Giarre, M., and Steenhout, P. Оценка безопасности, переносимости и защитного эффекта против диареи смесей для младенцев, содержащих смеси пробиотиков или пробиотиков и пребиотиков, в рандомизированном контролируемом исследовании.Am.J Clin.Nutr. 2008; 87 (5): 1365-1373. Просмотреть аннотацию.

    Crociani, J., Grill, J. P., Huppert, M. и Ballongue, J. Адгезия различных штаммов бифидобактерий к человеческим энтероцитоподобным клеткам Caco-2 и сравнение с исследованием in vivo. Lett.Appl.Microbiol. 1995; 21 (3): 146-148. Просмотреть аннотацию.

    Дас Р.Р. Сингх М., Шафик Н. Пробиотики в лечении аллергического ринита. Журнал Всемирной организации аллергии 2010; 3 (9): 239-244.

    del Giudice, M. M. и Brunese, F. P. Пробиотики, пребиотики и аллергия у детей: что нового за последний год? J Clin.Гастроэнтерол. 2008; 42 Приложение 3, часть 2: S205-S208. Просмотреть аннотацию.

    Фирмансьях, А., Двапурванторо, П.Г., Кадим, М., Алатас, С., Конус, Н., Лестарина, Л., Буиссе, Ф., и Стинхаут, П. Улучшение роста малышей, которых кормили молоком, содержащим синбиотики. . Азия Pac.J Clin.Nutr. 2011; 20 (1): 69-76. Просмотреть аннотацию.

    Джанотти, Л., Морелли, Л., Гальбиати, Ф., Роккетти, С., Коппола, С., Бенедуче, А., Джилардини, К., Зоненсчейн, Д., Несполи, А., и Брага, M. Рандомизированное двойное слепое исследование периоперационного введения пробиотиков пациентам с колоректальным раком.Мир Дж. Гастроэнтерол. 1-14-2010; 16 (2): 167-175. Просмотреть аннотацию.

    Гриль, Дж. П., Мангино-Дурр, К., Шнайдер, Ф. и Баллонге, Дж. Бифидобактерии и пробиотические эффекты: действие видов Bifidobacterium на конъюгированные соли желчных кислот. Curr.Microbiol. 1995; 31 (1): 23-27. Просмотреть аннотацию.

    Grzeskowiak, L., Gronlund, MM, Beckmann, C., Salminen, S., von, Berg A., and Isolauri, E. Влияние перинатального пробиотического вмешательства на микробиоту кишечника: двойные слепые плацебо-контролируемые испытания в Финляндия и Германия.Анаэроб. 2012; 18 (1): 7-13. Просмотреть аннотацию.

    Hascoet, J.M., Hubert, C., Rochat, F., Legagneur, H., Gaga, S., Emady-Azar, S., и Steenhout, P.G. Влияние состава смеси на развитие микробиоты кишечника младенцев. J Педиатр, гастроэнтерол, питание. 2011; 52 (6): 756-762. Просмотреть аннотацию.

    Игараси М., Иияма И Като Р. Томита М. Асами Н. Эзава И. Влияние Bifidobacterium longum и лактулозы на прочность кости в моделях остеопороза после овариэктомии. Бифид 1994; 7: 139-147.

    Ишизеки, С. Сугита М. Таката М. и Яешима Т. Изучение эффектов введения бифидобактерий на микрофлору кишечника у младенцев с низкой массой тела при рождении: эффекты введения трех видов бифидобактерий. Журнал Японского педиатрического общества 2004; 108: 283.

    Ивабучи Н., Хирута Н. Канетада С. Яешима Т. Ивацуки К. Ясуи Х. Влияние интраназального введения Bifidobacterium longum BB536 на иммунную систему слизистой оболочки дыхательных путей и вирусную инфекцию гриппа у мышей.Наука о молоке 2009; 38 (3): 129-133.

    Ивабучи, Н., Такахаши, Н., Сяо, Дж. З., Мияджи, К., и Ивацуки, К. In vitro Th2-независимые цитокин-независимые Th3 подавляющие эффекты бифидобактерий. Microbiol.Immunol. 2007; 51 (7): 649-660. Просмотреть аннотацию.

    Ивабути, Н., Такахаши, Н., Сяо, Дж. З., Йонедзава, С., Яэшима, Т., Ивацуки, К., и Хачимура, С. Подавляющее действие Bifidobacterium longum на производство Th3-привлекающих хемокинов индуцировало с взаимодействиями Т-лимфоцитов с антиген-презентирующими клетками.FEMS Immunol.Med.Microbiol. 2009; 55 (3): 324-334. Просмотреть аннотацию.

    Iwabuchi, N., Xiao, J. Z., Yaeshima, T., and Iwatsuki, K. Пероральное введение Bifidobacterium longum уменьшает инфекцию вируса гриппа у мышей. Биол.Фарм.Булл. 2011; 34 (8): 1352-1355. Просмотреть аннотацию.

    Кабейр Б. М., Язид А. М., Стефани В., Хаким М. Н., Анас О. М. и Шухайми М. Оценка безопасности Bifidobacterium pseudocatenulatum G4 по оценке на мышах BALB / c. Lett.Appl.Microbiol. 2008; 46 (1): 32-37.Просмотреть аннотацию.

    Кагеяма Т., Накано и Томода Т. Сравнительное исследование перорального приема некоторых препаратов бифидобактерий. Медицина и биология (Япония) 1987; 115 (2): 65-68.

    Кагеяма Т., Томода Т. Накано Ю. Эффект введения бифидобактерий у пациентов с лейкемией. Бифидобактерии Microflora. 1984; 3 (1): 29-33.

    Кондо, Дж., Сяо, Дж. З., Сирахата, А., Баба, М., Абэ, А., Огава, К., и Шимода, Т. Модулирующие эффекты Bifidobacterium longum BB536 на дефекацию у пожилых пациентов, получающих энтеральное питание .Всемирный журнал J Gastroenterol 4-14-2013; 19 (14): 2162-2170. Просмотреть аннотацию.

    Кулькарни Н. и Редди Б. С. Ингибирующее действие культур Bifidobacterium longum на индуцированное азоксиметаном образование аберрантных очагов крипт и фекальную бактериальную бета-глюкуронидазу. Proc.Soc Exp.Biol.Med 1994; 207 (3): 278-283. Просмотреть аннотацию.

    Mah, KW, Chin, VI, Wong, WS, Lay, C., Tannock, GW, Shek, LP, Aw, MM, Chua, KY, Wong, HB, Panchalingham, A., and Lee, B.W. Влияние молочная смесь, содержащая пробиотики для фекальной микробиоты азиатских младенцев с риском атопических заболеваний.Педиатр. 2007; 62 (6): 674-679. Просмотреть аннотацию.

    Макрас, Л. Де Вуйст Л. Ингибирование бифидобактериями грамотрицательных патогенных бактерий in vitro вызвано производством органических кислот. Международный молочный журнал 2006; 16: 1049-1057.

    Мацумото, Т., Исикава, Х., Татеда, К., Яэшима, Т., Ишибаши, Н. и Ямагути, К. Пероральное введение Bifidobacterium longum предотвращает вызванный кишечником сепсис Pseudomonas aeruginosa у мышей. J Appl.Microbiol. 2008; 104 (3): 672-680.Просмотреть аннотацию.

    Momose H, Igarashi M Era T Fukuda Y Yamada M и Ogasa K. Токсикологические исследования Bifidobacterium longum BB536. Ойо якури 1979; 17 (5): 881-887.

    Намба К., Яешима Т. Исибаши Н. Хаясава Х и Ямадзаки Сёдзи. Ингибирующее действие Bifidobacterium longum на энтерогеморрагическую Escherichia coli O157: H7. Биологическая микрофлора 2003; 22 (3): 85-91.

    Намба К., Хатано М., Яешима Т., Такасе М. и Сузуки К. Влияние введения Bifidobacterium longum BB536 на инфекцию гриппа, титр антител к вакцине против гриппа и клеточный иммунитет у пожилых людей .Biosci.Biotechnol.Biochem. 2010; 74 (5): 939-945. Просмотреть аннотацию.

    Одамаки, Т., Сугахара, Х., Ёнэдзава, С., Яешима, Т., Ивацуки, К., Танабэ, С., Томинага, Т., Тогаши, Х., Бенно, Ю., и Сяо, JZ Влияние перорального приема йогурта, содержащего Bifidobacterium longum BB536, на количество клеток энтеротоксигенных Bacteroides fragilis в микробиоте. Анаэроб. 2012; 18 (1): 14-18. Просмотреть аннотацию.

    Одамаки, Т., Сяо, Дж. З., Ивабучи, Н., Сакамото, М., Такахаши, Н., Кондо, С., Ивацуки, К., Кокубо, С., Тогаши, Х., Эномото, Т., и Бенно, Ю. Колебания фекальной микробиоты у людей с поллинозом японского кедра во время сезона пыльцы и влияние приема пробиотиков. J Investig.Allergol.Clin.Immunol. 2007; 17 (2): 92-100. Просмотреть аннотацию.

    Odamaki, T., Xiao, JZ, Iwabuchi, N., Sakamoto, M., Takahashi, N., Kondo, S., Miyaji, K., Iwatsuki, K., Togashi, H., Enomoto, T. , и Бенно, Ю. Влияние потребления Bifidobacterium longum BB536 на фекальную микробиоту у людей с поллинозом японского кедра в сезон пыльцы.J Med.Microbiol. 2007; 56 (Pt 10): 1301-1308. Просмотреть аннотацию.

    Одамаки, Т., Сяо, Дж. З., Сакамото, М., Кондо, С., Яешима, Т., Ивацуки, К., Тогаши, Х., Эномото, Т., и Бенно, Ю. Распространение различных видов группы Bacteroides fragilis у лиц с поллинозом японского кедра. Appl.Environ.Microbiol. 2008; 74 (21): 6814-6817. Просмотреть аннотацию.

    Огата Т., Кингаку М. Яэсима Т. Терагути С. Фукуватари и Ишибаши Н. Хаясава Х. Фудзисава Т. Лино Х. Влияние приема йогурта Bifidobacterium longum BB536 на кишечную среду здоровых взрослых.Microb Ecol Health Dis 1999; 11: 41-46.

    Огата Т., Накамура Т. Анджитсу К. Яешима Т. Такахаши С. Фукуватари Й Ишибаши Н. Хаясава Х. Фудзисава Т. Иино Х. Влияние введения Bifidobacterium longum BB536 на кишечную среду, частоту дефекации и фекальные характеристики добровольцев. Biosci Microflora 1997; 16: 53-58.

    Орраге, К., Шостедт, С., и Норд, С. E. Влияние добавок с молочнокислыми бактериями и олигофруктозой на микрофлору кишечника при введении цефподоксима проксетила.J Antimicrob.Chemother. 2000; 46 (4): 603-612. Просмотреть аннотацию.

    Пуччио, Г., Кахоццо, К., Мели, Ф., Рошат, Ф., Гратволь, Д., и Стинхаут, П. Клиническая оценка новой закваски для младенцев, содержащей живые Bifidobacterium longum BL999 и пребиотики. Питание 2007; 23 (1): 1-8. Просмотреть аннотацию.

    Редди Б. С. и Ривенсон А. Ингибирующее действие Bifidobacterium longum на канцерогенез толстой кишки, молочной железы и печени, индуцированное 2-амино-3-метилимидазо [4,5-f] хинолином, пищевым мутагеном.Cancer Res. 9-1-1993; 53 (17): 3914-3918. Просмотреть аннотацию.

    Rouge, C., Piloquet, H., Butel, MJ, Berger, B., Rochat, F., Ferraris, L., Des, Robert C., Legrand, A., de la Cochetiere, MF, N ‘ Guyen, JM, Vodovar, M., Voyer, M., Darmaun, D., and Roze, JC Пероральные добавки с пробиотиками для недоношенных новорожденных с очень низкой массой тела при рождении: рандомизированное двойное слепое плацебо-контролируемое исследование. Am.J Clin.Nutr. 2009; 89 (6): 1828-1835. Просмотреть аннотацию.

    Секи М, Игараси Т Фукуда И Симамура С Касвашима Т Огаса К.Влияние кисломолочного продукта Bifidobacterium на «регулярность» среди пожилых людей. Nutr Foodstuff 1978; 31: 379-387.

    Sekine I, Yoshiwara S Homma N Takanori H Tonosuka S. Влияние молока, содержащего бифидобактерии, на хемилюминесцентную реакцию периферических лейкоцитов и средний корпускулярный объем эритроцитов — возможная роль Bifidobacterium в активации макрофагов. Therapeutics (Япония) 1985; 14: 691-695.

    Секин К., Кавашима Т. и Хашимото Ю. Сравнение уровней TNF-a, индуцированных Bifidobacterium longum, полученными от человека, и Bifidobacterium animalis, полученными от крысы, в перитонеальных клетках мышей.Бифидобактерии Microflora 1994; 13 (2): 79-89.

    Simakachorn, N., Bibiloni, R., Yimyaem, P., Tongpenyai, Y., Varavithaya, W., Grathwohl, D., Reuteler, G., Maire, JC, Blum, S., Steenhout, P. , Benyacoub, J., и Schiffrin, EJ. Толерантность, безопасность и влияние на фекальную микробиоту энтеральной смеси, дополненной пре- и пробиотиками, у детей в критическом состоянии. J Педиатр, гастроэнтерол, питание. 2011; 53 (2): 174-181. Просмотреть аннотацию.

    Сингх, Дж., Ривенсон, А., Томита, М., Шимамура, С., Ishibashi, N., and Reddy, B. S. Bifidobacterium longum, кишечная бактерия, продуцирующая молочную кислоту, ингибирует рак толстой кишки и модулирует промежуточные биомаркеры канцерогенеза толстой кишки. Канцерогенез 1997; 18 (4): 833-841. Просмотреть аннотацию.

    Soh, SE, Aw, M., Gerez, I., Chong, YS, Rauff, M., Ng, YP, Wong, HB, Pai, N., Lee, BW, and Shek, LP Пробиотические добавки в первые 6 месяцев жизни у азиатских младенцев из группы риска — влияние на экзему и атопическую сенсибилизацию в возрасте 1 года.Клиническая экспертиза аллергии 2009; 39 (4): 571-578. Просмотреть аннотацию.

    Тахри К., Кроциани Дж., Баллонге Дж. И Шнайдер Ф. Воздействие трех штаммов бифидобактерий на холестерин. Lett.Appl.Microbiol. 1995; 21 (3): 149-151. Просмотреть аннотацию.

    Takahashi, N., Kitazawa, H., Iwabuchi, N., Xiao, J. Z., Miyaji, K., Iwatsuki, K., and Saito, T. Иммуностимулирующий олигодезоксинуклеотид из Bifidobacterium longum подавляет иммунные ответы Th3 на мышиной модели. Clin.Exp.Immunol. 2006; 145 (1): 130-138.Просмотреть аннотацию.

    Takahashi, N., Kitazawa, H., Iwabuchi, N., Xiao, JZ, Miyaji, K., Iwatsuki, K., and Saito, T. Пероральное введение иммуностимулирующей последовательности ДНК из Bifidobacterium longum улучшает Th2 / Th3 баланс в мышиной модели. Biosci.Biotechnol.Biochem. 2006; 70 (8): 2013-2017. Просмотреть аннотацию.

    Takahashi, N., Kitazawa, H., Shimosato, T., Iwabuchi, N., Xiao, JZ, Iwatsuki, K., Kokubo, S., and Saito, T. Иммуностимулирующая последовательность ДНК из пробиотического штамма Bifidobacterium longum подавляет выработку IgE in vitro.FEMS Immunol.Med.Microbiol. 2006; 46 (3): 461-469. Просмотреть аннотацию.

    Takeda, Y., Nakase, H., Namba, K., Inoue, S., Ueno, S., Uza, N., and Chiba, T. Улучшается регуляция T-bet и молекул плотных контактов с помощью Bifidobactrium longum воспаление толстой кишки при язвенном колите. Воспаление. 2009; 15 (11): 1617-1618. Просмотреть аннотацию.

    Тан, М. Л., Лахтинен, С. Дж., И Бойл, Р. Дж. Пробиотики и пребиотики: клинические эффекты при аллергических заболеваниях. Curr.Opin.Pediatr. 2010; 22 (5): 626-634.Просмотреть аннотацию.

    Томода Т., Накано Ю. Кагеяма Т. Разрастание кишечных Candida и кандидозная инфекция у пациентов с лейкемией: эффект от введения бифидобактерий. Бифидобактерии Microflora 1988; 7 (2): 71-74.

    Томода Т., Накано Ю. Кагеяма Т. Изменения в небольших группах постоянной кишечной флоры во время приема противоопухолевых или иммунодепрессивных препаратов. Медицина и биология (Япония) 1981; 103 (1): 45-49.

    Томода, Т. Накано Ю. и Кагеяма Т. Вариация и прилипание видов бифидобактерий в кишечнике при пероральном введении бифидобактерий.Медицина и биология (Япония) 1986; 113 (2): 125-128.

    Сяо Дж., Кондол С. Одамаки Т. Мияджи К. Яэшима Т. Ивацуки К. Тогаши Х Бенно Й. Влияние йогурта, содержащего Bifidobacterium longum BB 536, на частоту дефекации и фекальные характеристики здоровых взрослых: двойное слепое перекрестное исследование. Японский журнал молочнокислых бактерий 2007; 18 (1): 31-36.

    Xiao, JZ, Kondo, S., Takahashi, N., Odamaki, T., Iwabuchi, N., Miyaji, K., Iwatsuki, K., and Enomoto, T. Изменения уровней TARC в плазме во время пыльцы японского кедра сезон и связь с развитием симптомов.Int.Arch.Allergy Immunol. 2007; 144 (2): 123-127. Просмотреть аннотацию.

    Xiao, JZ, Kondo, S., Yanagisawa, N., Miyaji, K., Enomoto, K., Sakoda, T., Iwatsuki, K., and Enomoto, T. Клиническая эффективность пробиотика Bifidobacterium longum для лечения симптомов аллергии на пыльцу японского кедра у субъектов, оцениваемых в отделении воздействия окружающей среды. Аллергол. 2007; 56 (1): 67-75. Просмотреть аннотацию.

    Сяо, Дж. З., Кондо, С., Янагисава, Н., Такахаши, Н., Одамаки, Т., Ивабути, Н., Ивацуки, К., Кокубо, С., Тогаши, Х., Эномото, К., и Эномото, Т. Эффект пробиотика Bifidobacterium longum BB536 [исправленный] в облегчении клинических симптомов и модуляции уровней цитокинов в плазме при поллинозе японского кедра во время сезона пыльцы. Рандомизированное двойное слепое плацебо-контролируемое исследование. J Investig.Allergol.Clin.Immunol. 2006; 16 (2): 86-93. Просмотреть аннотацию.

    Сяо, Дж. З., Кондо, С., Янагисава, Н., Такахаши, Н., Одамаки, Т., Ивабути, Н., Миядзи, К., Ивацуки, К., Тогаши, Х., Эномото, К., и Эномото, Т. Пробиотики в лечении поллиноза японского кедра: двойное слепое плацебо-контролируемое исследование. Клинический опыт аллергии 2006; 36 (11): 1425-1435. Просмотреть аннотацию.

    Яешима Т., Такахаши С. Мацумото Н. Исибаши Н. Хаясава Х. Лино Х. Влияние йогурта, содержащего Bifidobacterium longum BB536, на кишечную среду, фекальные характеристики и частоту дефекации: сравнение со стандартным йогуртом. Biosci Microflora 1997; 16: 73-77.

    Yaeshima T, Takahashi S Ogura A Konno T Iwatsuki K Ishibashi N Hayasawa H.Влияние неферментированного молока, содержащего Bifidobacterium longum BB536, на частоту дефекации и характеристики кала у здоровых взрослых. Журнал Nutrition Food 2001; 4 (2): 1-6.

    Яешима Т., Такахаши С Ота С. Накагава К. Исибаши Н Хирамацу А Охаши Т. Хаясава Х Иино Х. Влияние сладкого йогурта, содержащего Bifidobacterium longum BB536, на частоту дефекации и фекальные характеристики здоровых взрослых людей: сравнение со сладким стандартным йогуртом. Kenko Eiyo Shokuhin Kenkyu 1998; 1 (3/4): 29-34.

    Ямазаки, С., Мачии, К., Цуюки, С., Момосе, Х., Кавашима, Т. и Уэда, К. Иммунологические реакции на моноассоциированные Bifidobacterium longum и их связь с предотвращением бактериальной инвазии. Иммунология 1985; 56 (1): 43-50. Просмотреть аннотацию.

    Yap GC, Mah KW Lay C Shek LPC Aw M Chua KY Tannock GW Lee BW. Выявление фекальных Bifidobacterium infantis на первом году жизни у младенцев с риском атопии, получавших Lactobacillus rhamnosus GG и Bifidobacterium longum от рождения до 6 месяцев.Журнал Всемирной организации аллергии. 2007; WAC 2007 Abstracts S130.

    Зивковиц, М., Фекаду, К., Зонтаг, Г., Набингер, У., Хубер, У.В., Кунди, М., Чакраборти, А., Фуасси, Х., и Кнасмюллер, С. Предотвращение образования гетероциклических аминов -индуцированное повреждение ДНК в толстой кишке и печени крыс различными штаммами лактобацилл. Канцерогенез 2003; 24 (12): 1913-1918. Просмотреть аннотацию.

    АльФалех К., Анабрис Дж., Басслер Д., Аль-Харфи Т. Пробиотики для профилактики некротического энтероколита у недоношенных детей.Кокрановская база данных систематических обзоров 2011 г., выпуск 3. Ст. №: CD005496. DOI: 10.1002 / 14651858.CD005496.pub3. Просмотреть аннотацию.

    Аруначалам К., Гилл Х.С., Чандра РК. Повышение естественной иммунной функции за счет диетического потребления Bifidobacterium lactis (HN019). Eur J Clin Nutr 2000; 54: 263-7. Просмотреть аннотацию.

    Бибилони Р., Федорак Р.Н., Таннок Г.В. и др. Пробиотическая смесь VSL # 3 вызывает ремиссию у пациентов с активным язвенным колитом. Am J Gastroenterol 2005; 100: 1539-46. Просмотреть аннотацию.

    Bouhnik Y, Pochart P, Marteau P, et al. Восстановление фекалий у людей жизнеспособных бифидобактерий, попавших в ферментированное молоко. Гастроэнтерология 1992; 102: 875-8. Просмотреть аннотацию.

    Чен Р.М., Ву Дж.Дж., Ли С.К. и др. Увеличение кишечных бифидобактерий и подавление бактерий группы кишечной палочки при кратковременном приеме йогурта. J Dairy Sci 1999: 82: 2308-14. Просмотреть аннотацию.

    Chiang BL, Sheih YH, Wang LH, et al. Повышение иммунитета путем употребления с пищей пробиотических молочнокислых бактерий (Bifidobacterium lactis HN019): оптимизация и определение клеточных иммунных ответов.Eur J Clin Nutr 2000; 54: 849-55. Просмотреть аннотацию.

    Colombel JF, Cortot A, Neut C, Romond C. Йогурт с Bifidobacterium longum снижает желудочно-кишечные эффекты, вызванные эритромицином. Ланцет 1987; 2: 43.

    Кремонини Ф, Ди Каро С., Ковино М. и др. Влияние различных пробиотических препаратов на побочные эффекты, связанные с терапией против Helicobacter pylori: параллельное групповое, тройное слепое, плацебо-контролируемое исследование. Am J Gastroenterol 2002; 97: 2744-9. Просмотреть аннотацию.

    Элмер GW, Суравич CM, МакФарланд LV.Биотерапевтические агенты, метод лечения и профилактики отдельных кишечных и вагинальных инфекций, которым пренебрегают. JAMA 1996; 275: 870-5. Просмотреть аннотацию.

    Gionchetti P, Rizzello F, Venturi A, et al. Пероральная бактериотерапия в качестве поддерживающей терапии у пациентов с хроническим поучитом: двойное слепое плацебо-контролируемое исследование. Гастроэнтерология 2000; 119: 305-9. Просмотреть аннотацию.

    Голдин BR. Польза пробиотиков для здоровья. Br J Nutr 1998; 80: S203-7. Просмотреть аннотацию.

    Ha GY, Yang CH, Kim H, Chong Y.Случай сепсиса, вызванного Bifidobacterium longum. J Clin Microbiol 1999; 37: 1227-8. Просмотреть аннотацию.

    Хираяма К., Рафтер Дж. Роль пробиотических бактерий в профилактике рака. Microbes Infect 2000; 2: 681-6. Просмотреть аннотацию.

    Hoyos AB. Снижение частоты возникновения некротического энтероколита, связанного с энтеральным введением Lactobacillus acidophilus и Bifidobacterium infantis новорожденным в отделении интенсивной терапии. Int J Infect Dis 1999; 3: 197-202. Просмотреть аннотацию.

    Исикава Х., Акедо И., Умесаки Ю. и др.Рандомизированное контролируемое исследование влияния ферментированного бифидобактериями молока на язвенный колит. J Am Coll Nutr 2003; 22: 56-63. Просмотреть аннотацию.

    Isolauri E, Arvola T, Sutas Y, et al. Пробиотики в лечении атопической экземы. Clin Exp Allergy 2000; 30: 1604-10. Просмотреть аннотацию.

    Калима П., Мастертон Р.Г., Родди П.Х. и др. Инфекция Lactobacillus rhamnosus у ребенка после трансплантации костного мозга. J Infect 1996; 32: 165-7. Просмотреть аннотацию.

    Като К., Мизуно С., Умесаки Ю. и др.Рандомизированное плацебо-контролируемое исследование по оценке влияния ферментированного бифидобактериями молока на активный язвенный колит. Алимент Фармакол Тер 2004; 20: 1133-41. Просмотреть аннотацию.

    Kim HJ, Camilleri M, McKinzie S, et al. Рандомизированное контролируемое испытание пробиотика VSL # 3 в отношении кишечного транзита и симптомов синдрома раздраженного кишечника с преобладанием диареи. Aliment Pharmacol Ther 2003; 17: 895-904. . Просмотреть аннотацию.

    Корщунов В.М., Смеянов В.В., Ефимов Б.А. и др. Терапевтическое применение препарата устойчивых к антибиотикам бифидобактерий у мужчин, подвергшихся воздействию высоких доз гамма-излучения.J Med Microbiol 1996; 44: 70-4. Просмотреть аннотацию.

    Кухбахер Т., Отт С.Дж., Хельвиг У. и др. Бактериальная и грибковая микробиота в связи с пробиотической терапией (VSL # 3) при поучите. Кишечник 2006; 55: 833-41. Просмотреть аннотацию.

    Льюис С.Дж., Фридман АР. Обзорная статья: использование биотерапевтических средств в профилактике и лечении желудочно-кишечных заболеваний. Aliment Pharmacol Ther 1998; 12: 807-22. Просмотреть аннотацию.

    Leyer GJ, Li S, Mubasher ME, et al. Воздействие пробиотиков на частоту и продолжительность симптомов простуды и гриппа у детей.Педиатрия 2009; 124: e172-e179. Просмотреть аннотацию.

    Ливин В., Пайффер И., Худо С. и др. Штаммы Bifidobacterium из резидентной микрофлоры желудочно-кишечного тракта человека грудного возраста обладают антимикробной активностью. Gut 2000; 47: 646-52. Просмотреть аннотацию.

    Macfarlane GT, Каммингс Дж. Х. Пробиотики и пребиотики: может ли регулирование активности кишечных бактерий принести пользу здоровью? BMJ 1999; 318: 999-1003. Просмотреть аннотацию.

    McFarland LV. Мета-анализ пробиотиков для профилактики диареи, связанной с антибиотиками, и лечения болезни Clostridium difficile.Am J Gastroenterol 2006; 101: 812-22. Просмотреть аннотацию.

    Мейдани С.Н., Ха В.К. Иммунологические эффекты йогурта. Am J Clin Nutr 2000; 71: 861-72. Просмотреть аннотацию.

    Miele E, Pascarella F, Giannetti E. et al. Влияние пробиотического препарата (VSL # 3) на индукцию и поддержание ремиссии у детей с язвенным колитом. Am J Gastroenterol 2009; 104: 437-43. Просмотреть аннотацию.

    Мимура Т., Риццелло Ф., Хельвиг У. и др. Терапия пробиотиками в высоких дозах (VSL # 3) один раз в день для поддержания ремиссии при рецидивирующем или рефрактерном поухите.Кишечник 2004; 53: 108-14. Просмотреть аннотацию.

    О’Махони Л., Маккарти Дж., Келли П. и др. Lactobacillus и bifidobacterium при синдроме раздраженного кишечника: реакции симптомов и взаимосвязь с профилями цитокинов. Гастроэнтерология 2005; 128: 541-51. Просмотреть аннотацию.

    Phuapradit P, Varavithya W., Vathanophas K, et al. Снижение ротавирусной инфекции у детей, получающих смесь с бифидобактериями. J Med Assoc Thai 1999; 82: S43-S48. Просмотреть аннотацию.

    Пирс А. Практическое руководство по натуральным лекарствам Американской фармацевтической ассоциации.Нью-Йорк: The Stonesong Press, 1999: 19.

    Расталл РА. Бактерии в кишечнике: друзья и враги и как изменить баланс. J Nutr 2004; 134: 2022S-2026S. Просмотреть аннотацию.

    Раутио М., Джусими-Сомер Х, Каума Х и др. Абсцесс печени, вызванный штаммом Lactobacillus rhamnosus, неотличимым от штамма L. rhamnosus GG. Clin Infect Dis 1999; 28: 1159-60. Просмотреть аннотацию.

    Роберфроид МБ. Пребиотики и пробиотики: функциональная пища? Am J Clin Nutr 2000; 71: 1682S-7S.Просмотреть аннотацию.

    Saavedra JM, et al. Кормление младенцев в больнице бифидобактериями бифидум и термофильным стрептококком для профилактики диареи и выделения ротавируса. Ланцет 1994; 344: 1046-9. Просмотреть аннотацию.

    Сайранен, У., Пиирайнен, Л., Грастен, С., Томпури, Т., Матто, Дж., Саарела, М., и Корпела, Р. Влияние пробиотиков ферментированного молока и инулина на функции и микроэкологию кишечника. J Dairy Res 2007; 74 (3): 367-373. Просмотреть аннотацию.

    Saxelin M, Chuang NH, Chassy B и др.Лактобациллы и бактериемия на юге Финляндии 1989-1992 гг. Clin Infect Dis 1996; 22: 564-6. Просмотреть аннотацию.

    Scarpignato C, Rampal P. Профилактика и лечение диареи путешественников: клинический фармакологический подход. Химиотерапия 1995; 41: 48-81. Просмотреть аннотацию.

    Салливан А, Баркхольт Л, Север СЕ. Lactobacillus acidophilus, Bifidobacterium lactis и Lactobacillus F19 предотвращают связанные с антибиотиками экологические нарушения Bacteroides fragilis в кишечнике. Журнал Antimicrob Chemother 2003; 52: 308-11.Просмотреть аннотацию.

    Табберс М.М., Миллиано I, Роузбум М.Г., Беннинга М.А. Эффективны ли Bifidobacterium breve при лечении запоров у детей? Результаты пилотного исследования. Нутр Ж 2011; 10:19. Просмотреть аннотацию.

    Tursi A, Brandimarte G, Giorgetti GM, et al. Низкие дозы бальсалазида в сочетании с сильнодействующим пробиотическим препаратом более эффективны, чем один бальсалазид или месалазин при лечении острого язвенного колита легкой или средней степени тяжести. Med Sci Monit 2004; 10: PI126-31. Просмотреть аннотацию.

    Вентури А., Джиончетти П., Риццелло Ф. и др. Влияние нового пробиотического препарата на состав фекальной флоры: предварительные данные по поддерживающей терапии больных язвенным колитом. Aliment Pharmacol Ther 1999; 13: 1103-8. Просмотреть аннотацию.

    Сяо Дж. З., Такахаши С., Одамаки Т. и др. Чувствительность к антибиотикам штаммов бифидобактерий, распространенных на японском рынке. Biosci Biotechnol Biochem. 2010; 74 (2): 336-42. Просмотреть аннотацию.

    AAP сообщает об использовании пробиотиков и пребиотиков у детей — Практические рекомендации

    CARRIE ARMSTRONG

    Am Fam Physician.2011 г., 1 апреля; 83 (7): 849-852.

    В последние годы возрос интерес к добавлению пробиотиков и пребиотиков в пищевые продукты для оптимизации микрофлоры кишечника. Однако, как и в случае с антибиотиками, использование этих добавок должно подкрепляться доказательной медициной. Американская академия педиатрии (AAP) недавно провела обзор использования пробиотиков и пребиотиков в медицине, чтобы помочь врачам консультировать родителей по поводу использования этих продуктов в качестве пищевых добавок к продуктам для детей, включая детские смеси.

    Младенцы имеют стерильный желудочно-кишечный тракт при рождении, но бактериальная колонизация происходит быстро. Гестационный возраст, способ родов и диета, по-видимому, оказывают значительное влияние на этот процесс. Считается, что нарушение регуляции защитной системы слизистой оболочки кишечника в раннем возрасте является фактором многих хронических состояний, таких как атопические заболевания (например, астма, экзема, аллергический ринит) и аутоиммунные заболевания (например, рассеянный склероз, сахарный диабет 1 типа, хронические заболевания). воспалительное заболевание кишечника).Считается, что из-за их влияния на колонизацию кишечной микрофлоры и иммунную функцию ранняя диета младенца и микробная среда кишечника являются ключевыми факторами его или ее общего состояния здоровья.

    Пробиотики

    Пробиотики — это добавки, содержащие организмы, изменяющие микрофлору хозяина. Эти организмы обычно представляют собой виды Lactobacillus, Bifidobacterium и Streptococcus. Они способны преобладать и преобладать над потенциальными патогенными микроорганизмами в пищеварительном тракте человека и, как считается, продуцируют побочные продукты метаболизма, которые действуют как иммуномодуляторы.

    По состоянию на декабрь 2010 г. в США продавалось как минимум две смеси для младенцев, содержащие пробиотики. Один содержал Bifidobacterium lactis, а другой — Lactobacillus rhamnosus GG (LGG). Доказано, что добавление пробиотиков к сухой детской смеси вредно для здоровых доношенных детей. Однако нет никаких доказательств клинической эффективности, и рутинное использование этих формул не рекомендуется. Никакие исследования не сравнивали пользу для здоровья от использования этих смесей и грудного вскармливания.

    Пробиотики нельзя давать детям, которые серьезно или хронически больны, до тех пор, пока не будет установлена ​​безопасность этих продуктов. Оптимальная продолжительность приема пробиотиков неизвестна, как и оптимальная дозировка или вид. Долговременное влияние на микрофлору кишечника у детей также не известно.

    ОСТРАЯ ИНФЕКЦИОННАЯ ДИАРЕЯ

    Использование пробиотиков на ранних стадиях диареи, вызванной острым вирусным гастроэнтеритом, может сократить ее продолжительность на один день у здоровых младенцев и детей раннего возраста.Это преимущество зависит от штамма; LGG — самый эффективный пробиотик. Однако данные не подтверждают рутинное использование пробиотиков для предотвращения инфекционной диареи, за исключением особых обстоятельств (например, в детских учреждениях). Использование новой пятивалентной ротавирусной вакцины, вероятно, будет более эффективным, чем использование пробиотиков для предотвращения наиболее распространенной формы острой инфекционной диареи у младенцев.

    ДИАРЕЯ, СВЯЗАННАЯ С АНТИБИОТИКАМИ

    Имеются некоторые данные в поддержку использования пробиотиков для предотвращения диареи, связанной с антибиотиками, но нет доказательств их эффективности для лечения.LGG, B. lactis, Streptococcus thermophilus и Saccharomyces boulardii были наиболее распространенными пробиотиками, используемыми в рандомизированных контролируемых исследованиях (РКИ). РКИ, в которых изучались бы эффекты использования пробиотиков у детей с диареей, связанной с антибиотиками Clostridium difficile, не проводилось.

    АТОПИЧЕСКИЕ ЗАБОЛЕВАНИЯ

    Доказано, что кишечная бактериальная флора детей с атопическим заболеванием содержит больше Clostridium и меньше организмов Bifidobacterium, чем у детей без атопического заболевания.По этой причине была выдвинута гипотеза, что введение пробиотиков младенцам с риском атопического заболевания, особенно тем, кто находится на искусственном вскармливании, будет полезным. Имеются некоторые данные, подтверждающие профилактическое использование пробиотиков матерями во время беременности и продолжение терапии у матери и ребенка во время кормления грудью, но необходимы дальнейшие исследования. Эффективность использования пробиотиков при лечении экземы не доказана.

    НЕКРОТИЗИРУЮЩИЙ ЭНТЕРОКОЛИТ

    У недоношенных детей часто наблюдается отсроченное и неправильное приобретение нормальной пищеварительной микрофлоры, возможно, из-за ограниченного энтерального питания и частого приема антибиотиков.Считается, что эти факторы способствуют повышенному риску некротического энтероколита у недоношенных детей. Имеются некоторые данные в поддержку использования пробиотиков у младенцев с очень низкой массой тела при рождении (масса тела при рождении от 1000 до 1500 г [2 фунта, 4 унции до 3 фунтов, 5 унций]). Однако количество и конкретный тип пробиотика определить сложно.

    ХРОНИЧЕСКОЕ ВОСПАЛИТЕЛЬНОЕ ЗАБОЛЕВАНИЕ КИШКИ

    По оценкам, до 70 процентов детей и взрослых с хроническим воспалительным заболеванием кишечника (т.д., болезнь Крона или хронический язвенный колит) обычно используют дополнительную и альтернативную медицину, включая пробиотики, в качестве дополнительной или заместительной терапии назначенных лекарств. Теоретически пробиотики могут быть полезны при лечении этих состояний. Однако долгосрочная польза от использования пробиотиков для лечения болезни Крона требует дальнейшего изучения и не рекомендуется для детей. Результаты РКИ, в которых пробиотики использовались для лечения хронического язвенного колита, обнадеживают, но требуют дальнейшего подтверждения.

    ДРУГИЕ УСЛОВИЯ

    Устойчивые или долгосрочные преимущества использования пробиотиков для лечения таких заболеваний, как синдром раздраженного кишечника, запоры и внекишечные инфекции, требуют дальнейшего изучения; В настоящее время не рекомендуется применять детям. Есть некоторые свидетельства того, что пробиотики могут быть полезны при лечении детей с гастритом, вызванным Helicobacter pylori, и младенческими коликами; однако необходимы дальнейшие исследования, прежде чем можно будет дать рекомендации. Пробиотики не доказали свою эффективность при лечении или профилактике рака.Существуют проблемы безопасности при использовании пробиотиков у младенцев и детей с ослабленным иммунитетом, хронически ослабленных или серьезно больных и имеющих постоянные медицинские устройства.

    Пребиотики

    Пребиотики — это добавки, содержащие неперевариваемый ингредиент, обычно в форме олигосахаридов, который избирательно стимулирует благоприятный рост или активность местных пробиотических бактерий. Хотя пребиотики плохо перевариваются, их присутствие в пищеварительном тракте усиливает размножение пробиотических бактерий в толстой кишке, особенно видов Bifidobacterium.

    Грудное молоко содержит значительное количество пребиотиков и предпочтительно для младенцев в возрасте до шести месяцев. Добавление олигосахаридов в качестве пребиотиков к детской смеси не является необоснованным, но не имеет доказательств, подтверждающих клиническую эффективность. Неизвестно, рентабельно ли их использование.

    Использование пребиотиков для профилактики или лечения заболеваний у детей не было широко протестировано в РКИ, но имеющиеся данные показывают, что могут быть некоторые долгосрочные преимущества для профилактики атопической экземы и распространенных инфекций у здоровых младенцев.Тем не менее, прежде чем давать рекомендации, необходимы подтверждающие исследования, особенно у детей, которым дают смесь, которая не является частично гидролизованной.

    Устойчивость дополненных Bifidobacterium longum subsp. infantis EVC001 у младенцев на грудном вскармливании

    РЕФЕРАТ

    Попытки изменить дисбактериоз кишечника с помощью введения пробиотиков последовательно показали, что колонизация введенными микробами носит временный характер. Это исследование было направлено на определение возможности проведения начального курса Bifidobacterium longum subsp.Infantis (B. infantis) приведет к стойкой колонизации пробиотических организмов у младенцев, находящихся на грудном вскармливании. Были набраны матери, намеревающиеся кормить грудью, и им оказывалась поддержка в период лактации. Одна группа матерей кормила B. infantis EVC001 своим младенцам с 7 по 28 день жизни (n = 34), а вторая группа не вводила никаких пробиотиков (n = 32). Образцы кала были собраны в течение первых 60 постнатальных дней в обеих группах. Образцы фекалий оценивали с помощью секвенирования гена 16S рРНК, количественной ПЦР, масс-спектрометрии и измерения эндотоксинов.Младенцы, вскармливаемые B. infantis, имели значительно более высокие популяции фекальных Bifidobacteriaceae, в частности B. infantis, пока кормили EVC001, и эта разница сохранялась более 30 дней после прекращения приема EVC001. Олигосахариды в фекальном молоке были значительно ниже у младенцев, вскармливаемых B. infantis EVC001, что свидетельствует о более высоком потреблении олигосахаридов грудного молока B. infantis EVC001. Концентрации ацетата и лактата были значительно выше, а pH кала был значительно ниже у младенцев, получавших EVC001, демонстрируя изменения в кишечной ферментации.У младенцев, колонизированных Bifidobacteriaceae на высоких уровнях, уровень фекального эндотоксина в 4 раза ниже, что согласуется с наблюдаемыми более низкими уровнями грамотрицательных Proteobacteria и Bacteroidetes.

    ВАЖНОСТЬ Микробиом кишечника в молодом возрасте играет важную роль для долгосрочного здоровья и во многом определяется диетой. Пробиотики могут способствовать улучшению здоровья, но не было доказано, что они изменяют состав микробиома кишечника. Здесь мы обнаружили, что младенцы, находящиеся на грудном вскармливании, могут стабильно колонизировать на высоком уровне за счет предоставления B.infantis EVC001, со значительными изменениями в общем составе микробиома, сохраняющимися более месяца спустя, независимо от того, родились ли дети вагинально или путем кесарева сечения. Это наблюдение согласуется с предыдущими исследованиями, демонстрирующими способность этого подвида использовать гликаны грудного молока в качестве питательного вещества, и подчеркивает важность сочетания пробиотического организма с определенным субстратом. Колонизация B. infantis EVC001 привела к значительным изменениям в составе микробиома фекалий и была связана с улучшением биохимии фекалий.Комбинация грудного молока и ассоциированных с младенцами Bifidobacterium sp. впервые показывает, что устойчивые изменения микробиома кишечника человека возможны и связаны с улучшением функции кишечника.

    ВВЕДЕНИЕ

    Во многих странах с ограниченными ресурсами бифидобактерии являются доминирующими фекальными микробами у младенцев, находящихся на грудном вскармливании (1–3), тогда как в странах с богатыми ресурсами наблюдается заметная изменчивость, при этом некоторые исследования показывают низкое количество фекальных бифидобактерий среди младенцев, находящихся на грудном вскармливании. (4–6).Режим родов, диета и бифидобактерии в кале матери влияют на колонизацию ребенка бифидобактериями. Уменьшение количества кишечных бифидобактерий имеет клиническое значение, основанное на большом количестве доказательств того, что дисбактериоз кишечника в раннем возрасте предрасполагает к воспалению и увеличивает риск ожирения, атопических и аллергических заболеваний, воспалительных заболеваний кишечника (7–9) и сахарного диабета ( типы 1 и 2) (6, 10). Не случайно, что заболевания, связанные с дисбактериозом, значительно реже встречаются в странах с ограниченными ресурсами.

    Бифидобактерии, по-видимому, особенно важны, учитывая доказательства обращения вспять вызванного стрессом воспаления и повышенной проницаемости кишечника как in vitro, так и на моделях на животных (11–13). Пробиотики обещают стать потенциальным средством коррекции дисбактериоза в раннем возрасте и предотвращения заболеваний, связанных с кишечной микробиотой; однако многие коммерчески доступные пробиотические продукты на сегодняшний день показали лишь ограниченные преимущества. Частично это может быть связано с высокой степенью вариабельности чистоты и жизнеспособности существующих пробиотических продуктов (14).Кроме того, испытания пробиотиков на сегодняшний день продемонстрировали только временную колонизацию введенным штаммом (15-17). Вероятно, это является следствием экологической и эволюционной адаптации используемых пробиотических штаммов, поскольку возможна стабильная персистенция экзогенного штамма (18).

    Грудное молоко содержит пребиотические олигосахариды, которые не усваиваются младенцем-хозяином, но быстро потребляются ограниченным числом видов Bifidobacterium и Bacteroides (19). Bifidobacterium longum subsp.Infantis (B. infantis) является уникальным среди кишечных микробов своей способностью переноситься в цитоплазму и потреблять полный спектр олигосахаридов грудного молока (HMO) (20). Ранее мы сообщали о клинических испытаниях B. infantis EVC001 у доношенных детей, находящихся на грудном вскармливании, в которых диады мать-младенец получали либо поддержку лактации, либо поддержку лактации плюс пробиотик в течение 21 дня (21). Теперь мы представляем вторичный анализ образцов кала, собранных у этих младенцев. Мы предположили, что, учитывая емкость B.Infantis, чтобы превзойти другие кишечные бактерии для ОПЗ, младенцы, колонизированные этим штаммом в первые недели жизни, будут стабильно колонизированы, пока обеспечивается грудное молоко. Мы также предположили, что предоставление этого штамма увеличит количество короткоцепочечных жирных кислот в кале и снизит pH в кале, содержание HMO в кале и концентрацию эндотоксина в кале.

    РЕЗУЛЬТАТЫ

    Изменения в фекальном микробиоме. Среди младенцев, матери которых получали только поддержку лактации (без пробиотиков для младенцев [CON]), 22 из 32 достигли измеримого уровня колонизации бифидобактериями (> 1% бифидобактерий) в первый раз. 60 дней жизни; однако только 10 младенцев поддерживали популяцию Bifidobacterium более 50% от всего сообщества, несмотря на исключительно грудное вскармливание в течение этого периода времени.Репрезентативные изоляты Bifidobacterium от младенцев были преимущественно B. longum subsp. longum и B. breve (см. Таблицу S1 в дополнительном материале). Когда несколько смешивающих факторов (субъект, день отбора проб, способ родоразрешения) были скорректированы многомерным линейным моделированием с использованием MaAsLin, кесарево сечение (CS) значительно изменило состав фекального микробиома грудного ребенка в течение первых 60 дней жизни (рис. 1A). ). У младенцев, рожденных вагинально (DV), было более высокое содержание Bacteroidaceae и более низкое содержание Enterococcaceae, Pasteurellaceae, Carnobacteriaceae и Gemellaceae по сравнению с младенцами CS (рис.1B и C; Таблица 1).

    Рис. 1

    Среднее относительное количество преобладающих бактерий у младенцев с CON, рожденных с помощью CS (A) или DV (B). (C) Дифференциально многочисленные семейства были идентифицированы с помощью MaAsLin. Точки окрашены в зависимости от способа доставки, связанного с их дифференциальным изобилием: желтый, DV; фиолетовый, CS.

    ТАБЛИЦА 1

    Относительная численность наиболее распространенных таксономических групп (на уровне семьи) у младенцев, по способу рождения и исследуемой группе

    Среди младенцев, получавших B.Infantis EVC001, фекальные Bifidobacteriaceae были значительно выше у этих младенцев, чем у младенцев CON (рис. 2A и B; таблица 1). Кроме того, видоспецифическая количественная ПЦР (кПЦР) показала значительно более высокие средние уровни B. infantis у младенцев, получавших добавки (10,81 log 10 клеток на грамм кала [стандартное отклонение, или SD, 11,13]). Количество клеток (выраженное как логарифм клеток на грамм фекалий) на 10-й день после рождения в группе лечения EVC001 (рис. 2C) было выше, чем у младенцев CON, у которых средний уровень B.Infantis упал ниже предела обнаружения в течение 21-дневного периода кормления (с 7 по 28 дни после рождения) и в течение 60 дней после рождения (рис. 2C). После исходной выборки (P = 0,431, с поправкой на Holm-Sidak) разница была значимой между двумя группами с 10 по 60 день (P <0,0001, с поправкой на Holm-Sidak). Относительная численность Enterobacteriaceae, Clostridiaceae, Erysipelotrichaceae, Pasteurellaceae, Micrococcaceae и Lachnospiraceae была заметно снижена у младенцев, получавших добавки, по сравнению с младенцами CON на основе сравнения с использованием MaAsLin для учета субъекта, дня отбора проб и способа доставки в качестве мешающих переменных (рис.2D). Среднее относительное количество доминирующих таксономических семейств (± стандартное отклонение) показано в таблице 1 для каждого дня, каждого способа доставки и каждой группы обработки.

    FIG 2

    Среднее относительное количество преобладающих таксонов в кале младенцев, вскармливаемых CON (A) и EVC001 (B). (C) Логарифм 10 клеток B. infantis на грамм фекалий в течение периода приема добавок (дни с 8 по 29) и через 60 дней после рождения, с кривой аппроксимации Лесса с доверительными интервалами. (D) Дифференциально многочисленные семейства бактерий, идентифицированные с помощью MaAsLin.***, P <0,001.

    Чтобы изучить влияние кормления B. infantis EVC001 на фекальный микробиом младенцев CS, а также выяснить, устраняют ли какие-либо изменения влияние CS на фекальный микробиом младенца, взвешенные расстояния UniFrac сравнивали между способами доставки (CS по сравнению с DV) в пробиотике. -добавленные младенцы. После добавления средневзвешенное расстояние UniFrac между образцами в группах доставки значительно уменьшилось по сравнению с исходными образцами (P <0,001, тест множественных сравнений с поправкой Холма-Сидака) (рис.3А). Несмотря на эти изменения в составе микробного сообщества в целом, индекс разнообразия Шеннона существенно не отличался между младенцами, получавшими EVC001, и младенцами CON (P> 0,05, критерий множественных сравнений с поправкой Холма-Сидака) (рис. 3B). Стабильность сообщества сравнивалась за этот период времени с использованием взвешенного по численности индекса Жаккара. Фекальный микробиом младенцев, которых кормили B. infantis EVC001, был более стабильным с течением времени, чем у детей с CON, и эта более высокая стабильность сохранялась в течение 60 дней после рождения (P <0.001 повсюду; Тест множественных сравнений с поправкой Холма-Сидака) (рис. 4). Несмотря на то, что кормление B. infantis EVC001 прекратилось на 28-й день после рождения, младенцы, получавшие B. infantis EVC001, сохраняли значительно более высокое содержание фекальных B. infantis в течение 30 дней после приема добавки, по сравнению с контрольными младенцами, на основании секвенирования 16S рРНК и видоспецифической КПЦР.

    РИС. 3

    (A) Средневзвешенное расстояние UniFrac (± стандартное отклонение) между образцами кала от младенцев с CON и от младенцев в группе добавок EVC001.(B) Средний индекс разнообразия Шеннона (± SD). Обратите внимание, что B. infantis EVC001 кормили с 7-го дня. ***, P <0,001.

    FIG 4

    Индекс стабильности Жаккара для младенцев, вскармливаемых EVC001, и младенцев CON; Значительные различия были рассчитаны между EVC001 и другими группами с использованием множественных t-критериев с поправкой Холма-Сидака. ***, P <0,001.

    Изменения фекальных маркеров дисбактериоза. Чтобы выяснить, влияли ли состав и концентрация ОПЗ в материнском молоке на состав фекального микробиома, образцы молока от матери, участвовавших в исследовании, были проанализированы с помощью жидкостной хроматографии-масс-спектрометрии.Не было различий ни в концентрациях HMO в молоке между матерями в двух исследуемых группах (рис. 5A) (P = 0,41, тест Манна-Уитни), ни в концентрации 2′-фукозиллактозы, ключевого индикатора материнских мутаций в ген FUT2, который может влиять на микробиом фекалий младенца (4) (P = 0,83, тест Манна-Уитни; n = 34 и 32, соответственно) (Таблица 2). Состав и концентрация HMO в фекалиях младенцев являются маркерами потребления HMO кишечными микробами и / или абсорбции (22). Средняя концентрация HMO в фекалиях в образцах B.Младенцы, вскармливаемые EVC001, (4,75 мг / г [SD, 8,6]) были в 10 раз ниже, чем в образцах от младенцев CON на 29 день после родов (46,08 мг / г [SD, 26,78]; P <0,001 по данным множественного сравнения Тьюки test) (рис. 5В), что согласуется с увеличением использования проглоченных ОПЗ пробиотиком B. infantis EVC001. Почти все HMO в стуле уменьшились после колонизации B. infantis EVC001 (Таблица 3).

    Рис. 5

    (A) Средняя концентрация HMO (в миллиграммах на миллилитр, ± стандартное отклонение) в молоке среди участвовавших в исследовании матерей.(B) Средняя концентрация HMO в фекалиях (в миллиграммах на грамм кала, ± стандартное отклонение) в стуле младенцев на 6-й и 29-й день. (C) Средние органические кислоты (лактат и SCFA) в образцах фекалий на 6-й или 29-й день ( в микромолях на грамм, ± SD). Обратите внимание, что B. infantis EVC001 кормили с 7-го дня. ***, P <0,001.

    ТАБЛИЦА 2

    профилей HMO в молоке, собранных на 21 постнатальный день

    ТАБЛИЦА 3

    Профили HMO в фекалиях младенцев на исходном уровне (постнатальный день 6) и постнатальный день 29

    Жидкостная хроматография-масс-спектрометрия также использовалась для измерения лактата и короткоцепочечной жирности кислоты (SCFAs) в кале, поскольку они являются основными конечными продуктами метаболизма Bifidobacterium HMO.У младенцев, которых кормили B. infantis EVC001, было значительно повышено содержание лактата и ацетата в кале (фиг. 5C; таблица 4). Младенцы, получавшие B. infantis EVC001, имели значительно большее количество фекальных органических кислот, чем младенцы CON на 29 день (71,41 ± 20,75 мкмоль / г по сравнению с 45,00 ± 14,73 мкмоль / г; скорректированный P <0,001, множественный t-тест с поправкой Холма-Сидака).

    ТАБЛИЦА 4

    Профили лактата и короткоцепочечных жирных кислот в кале младенцев на исходном уровне (6-й постнатальный день) и постнатальный день 29

    Чтобы проверить, изменяется ли pH кала одновременно с повышением концентраций лактата и ацетата, pH образцов кала в постнатальном На 21-й день у 18 случайно выбранных младенцев с CON были измерены.Среднее значение pH в фекалиях этих образцов составляло 5,97 ± 0,57. Напротив, фекалии 18 рандомизированно отобранных младенцев, получавших B. infantis EVC001, на 21 день имели средний pH 5,15 ± 0,42, что было значительно ниже pH фекалий младенцев CON (P <0,01, тест Манна-Уитни) ( Рис. 6А). Сравнение между группами младенцев показало, что абсолютные популяции Bifidobacterium в детском стуле отрицательно коррелировали с pH фекалий (ρ Спирмена = -0,62, P <0,01) (рис. 6B). Сравнивая взвешенные матрицы расстояний UniFrac, было обнаружено, что pH является значимым дискриминатором состава сообщества (тест Мантеля, R = 0.32, P = 0,002). Актинобактерии (тип, содержащий бифидобактерии) достоверно и отрицательно коррелировали с pH (ρ = −0,54 Спирмена, P = 0,018, поправка Бонферрони), в то время как протеобактерии значимо и положительно коррелировали с pH (ρ = 0,65, P <0,001, поправка Бонферрони). ).

    Рис. 6.

    Биохимические изменения, связанные с колонизацией EVC001. (A) Среднее значение pH фекалий (± стандартное отклонение) у младенцев, получавших EVC001 и CON. (B) Количество фекальных бифидобактерий (log 10 клеток на грамм фекалий) коррелирует с pH.(C) Медиана log 10 фекального эндотоксина (ЕС на миллилитр) у младенцев, получавших добавки (EVC001) и UNS. Точки представляют собой средние значения. **, P <0,01.

    Эндотоксин, важный компонент внешней мембраны грамотрицательных организмов (например, Proteobacteria и Bacteroidetes), достоверно и положительно коррелировал с относительной численностью Enterobacteriaceae (коэффициент Спирмена ρ = 0,51, P <0,001) и отрицательно коррелировал с численностью Bifidobacteriaceae. (Коэффициент Спирмена ρ = −0.42, P <0,001). У отдельных младенцев была высокая индивидуальная вариабельность, и средний log 10 фекальных единиц эндотоксина (ЕС) на миллилитр не был значительно ниже у младенцев, вскармливаемых B. infantis EVC001 (4,58 ± 0,89 log 10 EU / мл), чем у младенцев CON (4,90 ± 0,91 log 10 EU / мл; P = 0,92, критерий Манна-Уитни) (рис. 6C). Однако, когда для обнаружения и удаления выбросов использовалась надежная нелинейная регрессия (ROUT [23]), разница была значительной (4,25 ± 0,61 log 10 EU / мл в B.младенцы, получавшие грудное вскармливание EVC001, и 4,58 ± 0,75 log 10 ЕС / мл у младенцев с CON; P = 0,04). Более сильный эффект был обнаружен при учете относительной численности Bifidobacteriaceae у всех протестированных младенцев. Младенцы с высокой популяцией Bifidobacteriaceae (> 50%; n = 46) имели значительно более низкие концентрации эндотоксина, чем младенцы с низким уровнем обилия Bifidobacteriaceae (<50%; n = 13), с 4,68 log 10 EU / мл по сравнению с 5,36 log 10 EU / мл (P = 0,007, критерий Манна-Уитни).

    ОБСУЖДЕНИЕ

    Новорожденные быстро колонизируются организмами, с которыми они сталкиваются во время родов, из-за воздействия вагинальных и фекальных микробов во время родов через естественные родовые пути или воздействия на кожу и связанные с больницей поверхности во время кесарева сечения (24, 25). Несмотря на исключительно грудное вскармливание, в этом исследовании многие дети с CON оставались неколонизированными Bifidobacterium в течение первоначального 60-дневного периода исследования, а те, которые были колонизированы этим родом, имели виды, отличные от B.Infantis, преобладающий вид, обнаруживаемый у многих младенцев, находящихся на грудном вскармливании, в странах с ограниченными ресурсами (15, 26).

    Самым поразительным открытием этого исследования была стабильная колонизация B. infantis намного дольше периода приема добавок. Несмотря на то, что B. infantis EVC001 не поступал после 28-го дня, фекальные бифидобактерии, которые мы подтвердили как B. infantis EVC001 на основе количественной ПЦР, оставались доминирующим организмом у этих младенцев на 60-й день (рис. 2). Мы предполагаем, что эта продолжительная колонизация, которая редко наблюдалась в исследованиях пробиотиков (18), является функцией древних адаптаций B.longum subsp. Infantis в ОПЗ (27), и некоторые из этих адаптаций обеспечивают особое экологическое преимущество перед другими кишечными микробами (например, Bacteroides) (28). Таким образом, как инокуляция пробиотиками, так и постоянное обеспечение селективным питательным веществом (HMOs) для пробиотического штамма, вероятно, будут иметь важное значение для долгосрочной колонизации; эти данные аналогичны недавним открытиям для B. longum subsp. longum у взрослых (18).

    В дистальном отделе кишечника углеводы играют основную роль в формировании структуры микробного сообщества.ОПЗ являются энергетически дорогостоящими для матери, поскольку они производят и составляют третью по величине долю твердых веществ в материнском молоке (19). Учитывая, что ОПЗ не перевариваются младенцем, их много в стуле в отсутствие B. infantis или других микробов, потребляющих ОПЗ. Это может представлять собой потенциальный маркер дисбактериоза кишечника (то есть, когда в микробиоме кишечника преобладают микробы, не потребляющие HMO, такие как Proteobacteria и Firmicutes, содержание HMO в фекалиях высокое) (22, 29, 30). Было предложено несколько функций ОПЗ, от передачи иммунных сигналов до использования в качестве пребиотиков (31), а изменения концентраций ОПЗ в молоке и составах микробиома связаны с различными воздействиями на результаты для здоровья (3).В данном случае введение B. infantis EVC001 заметно снизило количество ОПЗ в фекалиях, что согласуется с высоким уровнем потребления B. infantis EVC001. Связанное с этим увеличение лактата и ацетата и снижение pH в фекалиях не было неожиданностью, учитывая, что центральный метаболический путь Bifidobacterium дает лактат и ацетат в качестве основных продуктов ферментации (32).

    В отсутствие Bifidobacterium сообщество, которое доминирует в микробиоме кишечника младенцев в богатых ресурсами странах, обычно характеризуется низкой стабильностью сообщества и пониженной устойчивостью к колонизации, которые являются одними из ключевых экосистемных функций микробиома кишечника (33).У младенцев, колонизированных B. infantis EVC001, стабильность сообщества высока и насыщена даже при низком уровне разнообразия сообщества по сравнению с экосистемой кишечника взрослых. Таким образом, мы предполагаем, что эволюционные и экологические адаптации, которые сформировали мать-младенец-B. infantis достигли оптимума, который максимизирует стабильность сообщества и ферментативный выход органических кислот на благо хозяина. Здесь мы обнаружили, что низкий рН фекалий отрицательно связан с протеобактериями, присутствие которых в кишечном сообществе считается признаком дисбактериоза (34).Вырабатывая лактат и ацетат, B. infantis EVC001 также может превращать неперевариваемые углеводы, которые в противном случае теряются с калом, в субстраты, которые активно транспортируются хозяином и играют центральную роль в общем энергетическом балансе хозяина, развитии иммунной системы и поддержке толстой кишки. рост эпителиальных клеток во время критического окна развития младенца (35, 36). Действительно, недавние исследования показали, что младенцы колонизируют B. infantis на уровнях, сопоставимых с таковыми у младенцев, которым вводили B.Infantis EVC001 улучшили показатели здоровья по сравнению с младенцами с дисбиотическими микробиомами кишечника (1), и что высокие уровни B. infantis типичны для здоровых младенцев (37). Будущие исследования потребуются, чтобы выяснить, насколько этот эффект сохраняется в более позднем детстве, и влияют ли эти эффекты на общее состояние здоровья в более позднем возрасте.

    МАТЕРИАЛЫ И МЕТОДЫ

    Субъекты исследования и дизайн. Детали дизайна клинического исследования были опубликованы ранее (21). Вкратце, диады мать-младенец были набраны в столичном регионе Дэвис и Сакраменто в Северной Калифорнии (США) (Таблица S2).Матери получали либо поддержку лактации, либо поддержку лактации и 1,8 × 10 10 КОЕ активированного B. infantis EVC001 (ATCC SD-7035; производство Evolve Biosystems, Inc.) для ежедневного кормления своих младенцев с 7-го по 28-й день после рождения. штамм B. infantis был выбран из-за его способности полностью переваривать ОПЗ (38–40). B. infantis EVC001 доставляли в виде 156 мг живых бактерий (> 1,8 × 10 10 КОЕ), разведенных в 469 мг лактозы в качестве наполнителя, и он был упакован в одноразовые саше.Консультанты по грудному вскармливанию обучили матерей смешивать содержимое пакетика с 5 мл сцеженного грудного молока и кормить этим грудного ребенка. Пробиотик хранился матерями при -20 ° C во время исследования, а стабильность при -20 ° C была подтверждена подсчетом на чашках. Выборка субъектов проиллюстрирована на рис. S1. Исследование и методы были одобрены Наблюдательным советом Калифорнийского университета в Дэвисе, и исследование было зарегистрировано на сайте Clinicaltrials.gov (NCT02457338).
    ).

    FIG S1

    Демографические данные субъекта, определяющие, получали ли матери антибиотики во время родов (идентификатор субъекта подчеркнут) или получали ли младенцы антибиотики во время или до момента отбора проб (треугольники), и получала ли мать поддержку в период лактации (серый цвет) или поддержку в период лактации и Б.Infantis EVC001 (бирюзовый). Скачать FIG S1, файл PDF, 0,2 МБ. Авторские права © 2017 Frese et al.

    Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0.
    .

    Сбор образцов. Образцы фекалий собирали дома на 6-е (исходное), 10, 14, 21, 25, 29, 32, 40, 50 и 60 дни после рождения, как описано ранее (21). В этот вторичный анализ были включены младенцы из группы, получавшей EVC001 (n = 34) и контрольной группы (n = 32, CON), которые продолжали исключительно грудное вскармливание или воздерживались от рутинного использования пробиотиков вне исследования.Соответствующие объемы образцов для анализа были доступны для 66 младенцев (рис. S1), которые соответствовали этим окончательным критериям исследования. Образцы стула хранили при -20 ° C в домашнем морозильнике и переносили на сухом льду в морозильную камеру -80 ° C для хранения перед экстракцией ДНК. Все лица, обрабатывающие и анализирующие образцы, были не осведомлены о назначениях исследовательской группы.

    Молекулярные методы и анализы. Общая ДНК была экстрагирована из примерно 100 мг фекалий с использованием набора Zymo fecal DNA miniprep kit в соответствии с инструкциями производителя (Zymo Research).Отрицательные контроли для обнаружения загрязнения набора были включены и не давали видимых полос ПЦР в агарозном геле, но были проанализированы в качестве контроля качества. Количественная ПЦР проводилась с использованием стандартных кривых известных культур, полученных серийным разведением и экстрагированных таким же образом, как и образцы фекалий. Отдельные образцы анализировали дважды в условиях, перечисленных в таблице 5. Реакции проводили в объемах 20 мкл с PerfeCTa SYBR green FastMix ROX (QuantaBio; Беверли, Массачусетс) или универсальной мастер-смесью TaqMan II с урацил-N-гликозилазой. (Thermo Fisher Scientific; Уолтем, Массачусетс, США) в 5 мкл экстрагированной ДНК в аппарате для кПЦР QuantStudio 3 (Thermo Fisher Scientific; Уолтем, Массачусетс, США).

    ТАБЛИЦА 5

    Праймеры, зонды и условия цикла, использованные в этом исследовании

    Разработка праймеров Blon_0915. Двунаправленный поиск BLAST был использован для сравнения типовых штаммов B. infantis и B. longum для идентификации подвид-специфичных генов. Гены-кандидаты были проверены против B. infantis EVC001 ATCC SD7035, и было обнаружено, что Blon_0915 присутствует как в типовом штамме B. infantis, так и в EVC001 ATCC SD7035 и других близкородственных штаммах B. infantis, но не среди других видов Bifidobacterium.Поиски BLASTN подтвердили эти результаты, указав, что Blon_0915 имеет низкую гомологию последовательностей среди других последовательностей Bifidobacterium в базе данных NCBI. Primer3 (41, 42) использовали для идентификации пар праймеров с высокой эффективностью и специфичностью для B. infantis. По сравнению с праймерами группы B. longum, использованными здесь (таблица 5), праймеры Blon_0915F и Blon_0915R в сочетании с Blon_0915P не вызвали ложной амплификации у младенцев, которых ранее не кормили B. infantis. Это было верно даже при тестировании в образцах фекалий младенцев, изначально колонизированных B.longum, что было независимо проверено с использованием наборов праймеров для КПЦР, специфичных для рода Bifidobacterium и B. longum (рис. S2). Реакцию TaqMan проводили в соответствии с инструкциями производителя (Thermo, Fisher Scientific; Waltham, MA, USA), которые включали этап предварительной инкубации в течение 2 минут при 50 ° C, а затем 10 минут при 95 ° C с последующими 40 циклами двухэтапная ПЦР в течение 15 с при 95 ° C и 60 с при 60 ° C для праймеров Blon_0915; другие химические составы праймеров / зондов приведены в таблице 5.

    FIG S2

    Перекрестная валидация методологии кПЦР Blon_0915 с образцами фекалий младенцев.ДНК, выделенная из образцов младенцев либо в контрольной группе (субъект 7071), либо в группе, получавшей EVC001 (субъект 7007), была использована для демонстрации того, что праймеры Blon_0915 неспособны амплифицировать другие виды группы B. longum (например, B. longum subsp. longum, как показано здесь). ДНК, выделенная из младенца, получавшего EVC001, также использовалась для демонстрации того, что праймеры Blon_0915 амплифицируют популяции B. infantis EVC001 только при скармливании B. infantis EVC001 и в популяциях, что отражено количественной оценкой с использованием ранее опубликованных праймеров, специфичных для рода Bifidobacterium.Скачать FIG S2, PDF-файл, 0,2 МБ. Авторские права © 2017 Frese et al.

    Этот контент распространяется на условиях международной лицензии Creative Commons Attribution 4.0.
    .

    Культивирование и идентификация изолятов Bifidobacterium. Фекальные изоляты Bifidobacterium были получены путем серийного разведения фекалий в стерильном фосфатно-солевом растворе (pH 7,0) и внесены путем посева на среду для селективной изоляции Bifidobacterium (4). Планшеты инкубировали в аноксическом режиме при 37 ° C в течение 48 часов и случайным образом отбирали и выделяли по 10 колоний на образец.Полученные штаммы были идентифицированы с помощью ПЦР-амплификации, и внутренние транскрибированные спейсерные ампликоны были идентифицированы с использованием праймеров и условий реакции (таблица 5), а затем очищены для секвенирования по Сэнгеру в центре секвенирования ДНК Калифорнийского университета в Дэвисе.

    Секвенирование и анализ 16S рРНК. Область V4 гена 16S рРНК была амплифицирована и секвенирована с использованием праймеров 515f и 806r, как описано ранее с недавними модификациями (43, 44) и как указано в таблице 5, в ламинарном потоке с HEPA-фильтром. кабинет, посвященный подготовке к ПЦР.Секвенирование ДНК с парными концами (300 п.н.) проводили в Центре генома Калифорнийского университета в Дэвисе на системе Illumina MiSeq. Последовательности анализировали с помощью QIIME 1.9.1 (45). Выбор операционных таксономических единиц (OTU) с открытыми ссылками был выполнен с использованием UCLUST при 97% идентичности (46). OTU с относительной численностью менее 0,005% были удалены (47). Образцы с менее чем 2779 считываниями были исключены из анализа, в ходе которого было удалено 10 образцов и образцы отрицательного контроля (образцы ПЦР и контрольные образцы экстракции). После качественной фильтрации для каждого образца было получено среднее значение 9 216 (± 4 505 [стандартное отклонение]) и среднее значение 7 749 считываний.Индекс наблюдаемых видов, индекс филогенетического разнообразия Фейта (48) и индекс разнообразия Шеннона использовались в качестве показателей для расчета альфа-разнообразия. Взвешенные расстояния UniFrac использовались в качестве метрики бета-разнообразия в дополнение к взвешенному по численности индексу Жаккара для расчета композиционной стабильности сообщества, совпадающей с ранее описанными метриками стабильности сообщества (26, 49). Многовариантное линейное моделирование (MaAsLin) использовалось для сравнения групп образцов на уровне семьи и рода, корректировки для субъекта, дня отбора, группы лечения и способа доставки (50).В частности, таксономические профили на уровне семьи образцов с 10 по 60 день были вменены в MaAsLin, и был проведен тест для корректировки объекта, дня сбора, режима доставки (DV или CS) и лечения (EVC001-fed или ПРОТИВ). MaAsLin был запущен с коэффициентом ложного обнаружения 0,05, минимум 0,0001 для фильтрации относительной численности признаков и минимум 0,01 для фильтрации распространенности признаков.

    Биохимические измерения. Грудное молоко, собранное на 21-й день после рождения, и пробы фекалий, собранные от исходного уровня (6-й день) до окончания кормления EVC001 (29-й день), были проанализированы на состав HMO, как описано ранее (22), а также проанализированы на лактат фекалий и SCFA, как описано ранее (51).Для измерения pH фекалий фекалии разбавляли 1:10 в стерильной воде, перемешивали с помощью вихревой мешалки в течение 4 минут и центрифугировали для осаждения твердых веществ (2 минуты, относительная центробежная сила 12000). Супернатант собирали и измеряли его pH (Oakton pH 700). Концентрацию эндотоксина в кале измеряли серийным разведением в стерильной воде, свободной от эндотоксинов, до нормального диапазона с использованием набора для количественного определения хромогенного эндотоксина Pierce LAL (Thermo Fisher Scientific, Waltham, MA). Образцы были измерены в двух экземплярах.

    Статистические методы. Статистические сравнения проводились, как описано в подписях к рисункам или в тексте. Линейное моделирование, дисперсионный анализ, тесты Манна-Уитни и множественные сравнения (с поправкой Холма-Сидака) выполнялись с использованием GraphPad Prism 7.0 (GraphPad Software, Inc., Ла-Хойя, Калифорния) или R (версия 3.2.3).

    Регистрационный номер (а). Библиотеки секвенирования, созданные в этом исследовании, депонированы в NCBI SRA (PRJNA3

    ) и общедоступны.

    БЛАГОДАРНОСТИ

    Авторы благодарят матерей и их младенцев, включенных в клиническое испытание, за сбор информации и образцов с методологическими подробностями.Мы благодарим наших сотрудников, Аннетт Файнберг, Кэтлин Ангкустсири, Дебору Альберт и Питера Трович, а также Хизер Конвей, Мари-Селин Фарвер, Ширли Герман и Лонну Хэмптон, консультантов исследования по грудному вскармливанию, которые предоставили участникам исследования поддержку и руководство для выполнения их цели грудного вскармливания.